Detailed Information [103522]

Strain Information
DGRC Number 103522
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Lk6[NP0101] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}Lk6NP0101 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 86F6
Map Viewer
Related Genes Lk6 CG6930
Original Number 101
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0101
NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1446
General Information NP_lines
Embryonic Expression sg,
Larval GFP sg
Larval X-gal sg
Adult GFP tarsas, antenna (S3)
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np10355_0727
Strand Plus
Insertion Point 7587240
Chromosome Band 3R
Flanking Sequence
ancttttggtgcactgantttanttgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGGAGGAGGCTGCACGTAGGCACCACTAGATGTCCTCCTA
TCGACAGGCCTCGATAGAATGAAAAACTTCTCGATAATTATGGAAAATTATTATGgatcg
aagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcag
gaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatc
cctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcga
tacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttat
tctatgctgtctcaatgttagaggcatatcagtctccctngcatcnnnttnnnnnggggg
gnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE