Detailed Information [103527]

Strain Information
DGRC Number 103527
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG3534[NP0113] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}CG3534NP0113 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 89E6
Map Viewer
Related Genes CG16941 CG17556 CG3534
Original Number 113
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0113
NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1521
General Information NP_lines
Lethality semi lethal
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np52315_0227
Strand Plus
Insertion Point 12822197
Chromosome Band 3R
Flanking Sequence
gattcttggngcactgancctaantttatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgTGTGGGNCCGACAACAAAAGCCGAGTCTCTCGNGCTCTC
CGGGTATTAAAGCCGTGGAATCGGNCAGTGNCGCACGCGGCGCTGTGTTTAATTTTTCCA
ACTCCCAACAGATCGNANAATNCATAANAGANAACCGTCGCCAANNAACCCATTATNGTN
GGGNACCGACGTTCAGGAAGGGCAAGCCATCCGACATGNCATCCTNTTNAGACCAATCAA
ATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGTGGAGTTATCATGATGAG
CTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTTGNTACTACTNTCTTNCGATG
ATGATGTNGAACTTATNCTATGCTGTCTCAATGTTAGAGGCATATCAGTTCTCCACTGAA
NCCANTCTATNTGACATNNTCNNTGTCTTCCNNNNNNNNTTNTNTCCNTATNTTNTTTTT
GAATTGAANCCCNNTTTTTNANNTNGNGCCAACCCCATGNCANTNANTNNACNCNNNCTN
CNGNCCCTTTNTNGTTTTTCCTNCCNGNCCCNNACGTGTCTTTNNTNTTTTTTTTTTTNN
CTTTGTTACNCNATCAANNNTGNTTNCNCTTTTNTTTNNTCCTNTAGTANNAAGCGNGNT
TCNATTANCTCTGNTACTTNCCCCCCTNGTATTTTTTCGANCNGCNNNGGTTGCCNNATC
TNATNGNNCCNCCNTNGCACtttnnngtncngnttnnnnatcncccnttngnncttncta
tncttcccncccttannncccatttnttnngttgggntgtacnattttttnngnttcttt
ttcaantntnnnntctcttnacntttttntntttctttncctnnctnttctctnncnncn
gttnnctnntnttttcnccncncatnantccntcgttgttttttatnntntgggnncata
ctnatttanctntctnttcacncccttcngtnctnnnatcnntnt

Image Files
Disc

d1 (->Large)


CLOSE