Detailed Information [103533]

Strain Information
DGRC Number 103533
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}hyx[NP0125] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}hyxNP0125 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 85C3
Map Viewer
Related Genes neur CG11990
Original Number 125
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0125
NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1400
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05095_0711
Flanking Sequence
CAAAACGTTGGCCACTTGGGAAATTTTTAAGGGTTGGTTATTAACTTTTCGGGTTAANGC
NTTCGGGCTTATTCNGAANGGGANCCCCCCNTTANGGTTTANTTTTCANTCNNTGGGGCC
AAANGCNTTTAAAANGGCCNTCNGCANTTTTAANCGCCNTANTGAATTCCCGGAAGGTGG
ANGCNTAGCCCTGCCCANTAGCCACACGAATCCGAANGAANTCCNTNANGAAGAAGAANC
CGTNNGCCCAAANGAAACCCNTTNTTGTTGGGGGTCCCGTTTTNNGGAAAGGGCANGCCN
TCCCGACNTGTNATCCNTTTTNAGAACCANTCAAATCCATGAAGNGCATCCCTGGGCNTA
AAATCCAACGGANTTGTGGNGTTATNATGATGAGCTGCCGAGTNAATCGATNCAGCNAAC
TGTNTTTGACCTTNGTTACTACTCTNTTCCGATGATGATGTCGCACTTATTNTATGCTGT
CTCAATGTTAGAGGCATATCAGTCTCCACTGAGCATNNNNNNNNGGGGGNNNNNNNNNTN
TNNNNANNGNGNNTNNCNNNTNTNNNCCCCNGNTTNGAANATGANTNAAAAANCTNTGGN
CNTTCCAATNGGNNTGNNNNCNTNNNNNNNNNCNNNANNNTNNNNNGNNGNNAAACNNNN
NNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNAACCNNNNNTNGNNGNNNNNNNN
NNNNNGGNNGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnncnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np54843_0309
Strand Plus
Insertion Point 4865136
Chromosome Band 3R
Flanking Sequence
acttctttagngcgcacttatngcaagtnatacgttaagtggatgtctcttgccgacggg
accaccttatgttatttcatcatgGCTTTGCCTAATTGTTATTTGGATGGAGCTGCCGGT
CGCAAGGCTTTTTTTTAGTGTGACCCGNGGNCGGNCGCATAGGCCACTAGCGGATCTGGA
TCCTCTAGCTAGNGACTNTGCCATACAATATTTATAAATAAACAAATCACTAGACGCGCT
AGAAAAGTCATTTACTTCGTTTATTAATGATGCCAATTCCTGAAGATGTGAAGTGTTCTA
AAGAGTTGTCGTTGTATAACGTGCCATTAAGAAAACTAATTGTTAACAAATCACAGGATA
CGAAAAGCCGTGACTTAGTGCGATATTTTTTAAAGACGAAACTTCAGCGATTTATACCAA
ATGAGAAGCGATGCACTCTCTATGATATTTGGTATTTTTCACCCCGCCTACGGNCACACT
CCACGCAACCTNTGGCAAAAAACTAAAAATATGCCATAAAAAGCGAGAATCGAAGTTGNT
TATATATCTTTCGCGGATTACAAAGNGCGTAGCCGCCGNGCGCCTTNCAGAGCGACACCC
GACCACACACGCCCGNCGNCCGNAAAACACACACAAACCGGCAGAAAAAAGGCANATCCT
CTAGCNGGNNNTTTNGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)


CLOSE