Detailed Information [103536]

Strain Information
DGRC Number 103536
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP0134 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP0134 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 50A3
Map Viewer
Related Genes CG17047 CG17048
Original Number 134
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0134
NP line. Received from the National Institute of Genetics.
Balancer CyUW14
Cluster id 731
General Information NP_lines
Lethality lethal
Embryonic Expression weak stripe, anterior tip
Larval GFP cns + pns
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05105_0711
Strand Plus
Insertion Point 8399973
Chromosome Band 2R
Flanking Sequence
tnaacgtgcactgaatttaattgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgGCCTGGCCCCCACCATCCCGAAAAACGAAGCCCCCATCCTCA
AATCGGGGCAACTCTTTTGAGCTATTTTGGGAAAATTGTTTTGACTCCCGGCGAGGGGAA
ATTTTATTAAAATGTTTTGCGCACAGAAGGCAGAGGATGTGGAAATTAAATTGAAANCTT
AAACAAATTTAGCTGGGGGCGGCTCACGAAATTAGCACAAGGACAAAGCCCGACAGCAAA
TCCCGCANGGATACGTGGGGAAAAAACGTGCGACATGTTGCTAATTTTTTTTCCACTCTG
GCTCCTGCGTAATGTAATGAAAAAATGTGGNGCANCAGAAGACGAGACANCTAACTAACA
NCAAACAGAGAGCGAATTCCCCGNGGGCGAACAAACAATTCGNGGAAAAAAGCTAGAAAA
CCTGGCTGGCTAAATGGCACAAAAAATGGGTAAAAATAATACCGAAAAGAGGTGAGATAT
AGGGAGCGTTGGCTCAACATTTTCATTTGATAGGGAGGAGGAGGATTTCTNTACAGAGTC
GCATATTCAACAGGAAAATCCCTTAATTGGAATAAATTAACTGTTATTGCTGGGGCATCC
ACACACATGTACAGCCGCACNCAGTTNAAATAGAGATACAAATACATTCGTTGCTATCAT
TTTGCGCTGCTCCCAATGGGGCATGTAGTTGTATCTGNNCCTTTGCATCCATGAGNGGGG
GCATTCGATCTGCTGGGGGCttgggggggggatntaaaagtcccttttttttcnctcagc
aangngggaccccangcnncntaccaanttaatnntttgntaaagcgaatttttgacccg
nggcccccttgcnccgccaaaagngggaaaaaaggaacctgccaaaaacatttggagnaa
ctgnttgn

Image Files
Disc

d1 (->Large)


CLOSE