Detailed Information [103538]

Strain Information
DGRC Number 103538
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}CG6461[NP0136] / FM7c
Genotype y* w* P{w+mW.hs=GawB}CG6461NP0136 / FM7c
Break points/Insertion Site 17C1
Map Viewer
Related Genes Wnt5 CG6461 CG6470
Original Number 136
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0136
NP line. Received from the National Institute of Genetics.
Balancer FM7c
Cluster id 428
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Liu J, Gong Z, Liu L.
-glutamyl transpeptidase 1 specifically suppresses green-light avoidance via GABAA receptors in Drosophila.
J Neurochem. (2014) 130(3) 408-18 [PubMed ID = 24702462] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np04085_0711
Strand Plus
Insertion Point 18240205
Chromosome Band X
Flanking Sequence
anctttaangtgccactgactttaattgtatacttcggtaagcttcggctatcgacgggc
accaccttatgttatttcatcatgGCCTGGATTGTAATCTCTGGACATGGACACTAGGGC
ACTAGTTAAATCAAATTAGCCGAATCATTGCGATCGANNAATACATAAGAGAGAACCGTC
GCCAAAGAACCCATTATTGTTGGGGTCCGTTTTCAGGAAGGGCANGCCATCCGACATGTC
ATCCTCTTGAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAAT
TGTGGAGTTATCATGATGAGCTGCCGAGNCAATCGATACAGTCAACTGTCCTTTGACCTT
TGTTACTACTCTCTTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAG
GCATATCAGTCTCCACTGAGCCATCTNATTTTGGGGNNNNNNNNNNNNNNNANCCGNNNN
CNANNAACCNATTATTGNNNGNGGTCCGNNNTNAGGGANGGNNANNCCNTCCCNNNATGT
CAATCCTNNTTNNNANCNANTNNANNNCATGNANAGCCTNCCNNGNGNANAAAAANNCNA
NCNGNAATNNNGGGNNNNATNANNGANNAGCTGNCNNNNNAANNNNNNCCANNNNACTGN
NNNNNNCCTTNNNNACTANTNNNNTTNNNNANNANNANGNNNNNCNTNNTNNTTTNCTNN
NTNNANGNNNNNAGGCTNTTNANNCNNNNCTGAAGCNTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE