Detailed Information [103542]

Strain Information
DGRC Number 103542
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}NP0154 / FM7c
Genotype w* P{w+mW.hs=GawB}NP0154 / FM7c
Break points/Insertion Site 11A1
Map Viewer
Related Genes fw CG1806
Original Number 154
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0154
NP line. Received from the National Institute of Genetics.
Balancer FM7c
Cluster id 300
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np04155_0711
Strand Plus
Insertion Point 11737730
Chromosome Band X
Flanking Sequence
tntcaacgtgcactgnanttaagtgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgGTTCAGGTATTTGAGGTGTAGCCATATGTGTACACACATA
CATGCATAGATGTGAGAGCATAAGTGGAAATGGCTCGCTTTAAAGCGCTCGATGAGAATT
ATTTTTAGTTTGTTTTCGCCTCTTGGTGCGTACAGTTGCACTCACgatcgaagaatacat
aagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaag
ccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcata
aaatccaacggaattgtggagttatcattgatgagcctgccgagtcaatcgatacagtca
actgtctttgacctttgttactactctcttccgatgaatgatgtcgcacttattctatgc
tgnctcaatgttagaggcatatcagtctccactgagcnatnttatattnnngggnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnntnnnnnnnnnnnnnnannnnnnnnnn
nnnnnnntnnnnnnnnncnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnn

Image Files
Disc

d1 (->Large)


CLOSE