Detailed Information [103549]

Strain Information
DGRC Number 103549
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}crp[NP0176] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}crpNP0176 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 35F1
Map Viewer
Related Genes BG:DS02740.2 crp 1360{}389
Original Number 176
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0176
NP line. Received from the National Institute of Genetics.
Balancer CyUW14
Cluster id 1207
General Information NP_lines
Lethality semi lethal
Embryonic Expression muscle
Larval GFP ubiquitous
Larval X-gal
Adult GFP ubiquitous
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05195_0711
Strand Minus
Insertion Point 16247645
Chromosome Band 2L
Flanking Sequence
tgaattaattgtatacttcggtaagcttcggctatcgacgggaccaccttatgttatttc
atcatgACGAAGACCATAGCCGTCTTGCTCTAACATTATACAATTACCCCTAACTGTCGA
AGAAGAGGAGAGTGGGAGAGTCAGAGCAAGAGAGCGACTCTCTCTAGCAACATTTGTGAC
GACGACGACGCCGGCGAATATTGAAAAACTTTTCGTATTGGAACTGTTGCTGGCTTCTTG
TTGGAAAAAAGTACAGTCACCGCAAAAGCGGCCGTCTGTTGTGTATTGTCGCTTTGTTGG
TTGGCTTGTGTTCGCTCTGAATTGGATTCTTGTTGGACCCGCCAGTTTgatcgaagaata
cataagagagaaccgtcgccaaagaacccattattgttgggggtccgttttcaggaaggg
caagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccctggc
ataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtc
aactgtctttgacctttgtactactctcttccgatgatgatgtcgcacttattctatgct
gtctcaatgttagaggcatatcagtctcactgagctnttttttttnggggnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)


CLOSE