Detailed Information [103550]

Strain Information
DGRC Number 103550
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}CG32700[NP0178] / FM7c
Genotype w* P{w+mW.hs=GawB}CG32700NP0178 / FM7c
Break points/Insertion Site 8E9
Map Viewer
Related Genes CG32700 CG32701 jockey{}90
Original Number 178
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0178
NP line. Received from the National Institute of Genetics.
Balancer FM7c
Cluster id 242
General Information NP_lines
Embryonic Expression cns, mg, good driver
Larval GFP cns
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05205_0711
Strand Minus
Insertion Point 9289839
Chromosome Band X
Flanking Sequence
tgacttaatttgtatacttcggtaagcttcggctatcgacgggaccaccttatgttattt
catcatgCATCGTCCATTTGTAACTCATTCGTCAACAGACTCTCGTGCGGTTCGGTTCTC
AGCCTCAGCCTTTGAATTCAGCATACTCACATCACAGTCGCAAGTCACTGGTCACTGGTC
ACAGTTCACAGTCACGCAGTTACTGCTTTTGCCCGGTTTTCGAGTTTTCGAAAGATATTC
GAAAGTGCTGAACATACATAATTTTTTTTTTTTGGGTTTTNGGGCTAATNNAAAAAATTG
GGTTTTTTTCCNTAAATTTCCCCCTAAGGGGCCNNAGGGTTNTGAAAACCCNTTTTTTAA
TTCGAANACAAACNNCCNNCCCCAAGGGAAAAAGGGGGGGGGGNAAANNTTTAAATCCCC
TTCCNGTTCCCATTCGGGGGNGGATTTGGNGGAAAAAGCTTGGAAANNAAAAAACNCCCC
CGAGNCAAAGGGGGGGGANGGGCTTGNCAAAAGGAAAATTGGGCAGCCCCCTTGGGAAAG
GNTTTAAATTCCCNCCGGGGGGNCCNTTTTCAAGTCCCGGAATTGGGGCTTTNTTTGCCC
AAACCAAACCGGAATGNATCCCCCCACNCGGTTTTTTANAAAACCAAAAAAGGGNNTTTN
NAACCTTCCCNTTTAGGGGGAATTNCNAAATNAAAAATTTGGTTTGGAAAAAAAAAANAA
TTTAAAAATGGNTTTGGGGGGNAANGANGGGAAATTTGGNAAAATTAAAGAATGGAAAAT
TTTTTTTAAAAAAAAGGGGNcnggntgaatgaaanaaatttttgggaaaattgccccnnt
ggaaaaaaanaaaatttntttggttngnggncccccccttaaatggggaacccttaaagg
gggtttaaaaaccccccaccccttattggcnccttaaanncctttgnaag


CLOSE