Detailed Information [103551]

Strain Information
DGRC Number 103551
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}NP0180 / FM7c
Genotype w* P{w+mW.hs=GawB}NP0180 / FM7c
Break points/Insertion Site 9F12
Map Viewer
Related Genes CG2145 Myo10A
Original Number 180
Chromosome 1
Comments NP line. Received from the National Institute of Genetics. All homozygotes
Balancer FM7c
Cluster id 276
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np04235_0711
Flanking Sequence
tgtcaacgtgcactgnanttaantgtatacttncggtaagcttcggctatcgacgggacc
accttatgttatttnatcatgCTTTGACCTTTGTTACTACTCTCTTCCGATGATGATGTC
GCACTTATTCTATGCTGTCTCAATGTTAGAGGCATATCAGTCTCCACTGAAGCCATCCTT
ATCTGAGACGGCATCTTTATTCACATTATCTTGTACAAATAATCCTGTTAACAATGCTTT
TATATCCTGNAAAGAATCCATTTTCAAAATCATGTCAAGGTCTTCTCGAGGAAAAATCAG
TAGAAATAGCTGTTCCAGTCTTTCTAGCCTTGATTCCACTTCTGTCAGATGTGCCCTAGT
CAGCGGAGACCTTTTGGTTTTGGGAGAGTAGCGACACTCCCAGTTGTTCTTCAGACACTT
GGCGCACTTCGGTTTTTCTTTGGAGCACTTGAGCTTTTTAAGTCGGCAAANATCGCATGC
TTGTTCGANAGAAGACAGNNGCTTCATCTTTCAAGAGGCTTGCTTNAAGCTTGGGCTGCA
NANTGNNTANCTTGNTCAGCTGCGCTTGNTTATTTGCTTANCGGCCGCNCNNNAGGGNTA
ATGGNTTTNAAAAAAAAATNNNNNNNNNNACAAACNTTNNTNTNAANAAGAAAANNNGCC
TGNAANNNAAANGGNNACNTTNNNNAAGNNNNNGNTNTNNNNNGGNNCNCCCNNANGNNA
TTNNANNANGNCNNNGNCCNNNGNNNCNNCCNNNNNNNNNNGGNNNANNNNNNANNNNTN
NNNNNNNNNNNNAAANNNNNnnnggnnannnnnnnncncngngnnannnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np54573_0309
Strand Plus
Insertion Point 10672600
Chromosome Band X
Flanking Sequence
gnnnnnngnngnggnggggnnnggnnnagggggnngggggggngnttnngttttnttggn
nnggantaaacnggnggntcaanaanccccannnttacgttagtggaagtcctcttgccg
acgggnaccaccttatgttatttcatcatgTGACTGCGTATCTTTGACAACGATTCCACC
TATAAATTCCAATAGGCGATTGCCTTTGACAACCCTGCAGTTGCACTCTTTCGCTTTCTC
GTTCTCTCGCGCTCTTGTTGTGCTCTCTCTGTCGGCAACAAGTGATCCTCTAGCTAGAGC
TTNGGCCACTAGNGGATGGGGAACCTANANCTAGAGCTATGANTNCNNNTAANTAATANN
ANGAGNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE