Detailed Information [103553]

Strain Information
DGRC Number 103553
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0188 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}NP0188 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 59B2
Map Viewer
Related Genes CycB blw
Original Number 188
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0188
NP line. Received from the National Institute of Genetics.
Balancer CyUW14
Cluster id 920
General Information NP_lines
Embryonic Expression many weak cells
Larval GFP sg
Larval X-gal sg, cns,
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np04265_0711
Strand Plus
Insertion Point 17846699
Chromosome Band 2R
Flanking Sequence
gtataccttcggtaagcttcggctatcgacgggaccaccttatgttatttcatcatgCAC
GGTACCAAAAAAAGGGAGAGAAAAGCGTTAAAAAGGGAAGAAGGAAAGGGAGAAGCGGAA
GAGAAGTAACTGACCTGCgatcgaagaatacataagagagaaccgtcgccaaagaaccca
ttattgttggggtccgttttcaggaagggcnaagccatccgacatgtcatcctnttcaga
ccaatnaaatccatnaagagcattccttggcntnaaatccaacggaattgtggagttttc
atnntggagctgcccgagtcaatnnatncngtnacctnncttttgnnccctttngttcct
cctttttttccgntgantgatgncccnacttntttctttgcgtggctnaatagnttanga
gcntatttaatnctncacntggaanccnatattntttttngnnnnnnnnnnnttnnnntn
nntttnnnnnntnnnnntntnnnctntntnnnnnnctnnnnnnntnntnntnnnnncctn
nnnntcncntncnnntnnntnntnttnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnn
nnnnnnnntnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnn
nnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nntnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnntnntnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnt
nnnntnnntnnnnnnnnnntnnnttnnnnnnnnnnnnnnnnnnnn


CLOSE