Detailed Information [103555]

Strain Information
DGRC Number 103555
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP0203 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP0203 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 48B1
Map Viewer
Related Genes CG9003 CG9005
Original Number 203
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0203
NP line. Received from the National Institute of Genetics.
Balancer CyUW14
Cluster id 688
General Information NP_lines
Lethality lethal
Embryonic Expression mesoderm
Larval GFP muscle, gut
Larval X-gal sg, epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np04325_0711
Strand Minus
Insertion Point 6702032
Chromosome Band 2R
Flanking Sequence
tttttnggtgcactgccntttntgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgAACCCACCAAAAAATTTTAACAGCTGATTGGTTTGGGAGGT
AGAAATTTGAGTGGTTTTTAGGGGGATGGTGCATGTCTCGTCTGGGAAATGCACCTCCCT
CTACCGAATTTGTGATTTACTTTGTGTTTAGAATANCTCACTGCTACAGGCAAGAGAGGG
GTGGCTGGAAGTTTCTGGGAGGGGCCAGTAACAAACAAAGCATTGGTTTTGATTGATATT
TCGTGCCAATGGGCTTTGATGGGAATTTGCATTTCTTTTCAATTTGCCTCCTTAATCGCT
TTCAATCAAAGCCAAAAAAAAAATTTTTAAAAAACAATCCGAAANTNTTNTTCCNNATGG
ACCTTTTTTAANTGGCAANAAAAGCCTTTTGGTTANAATTTTTGGTTGGCCTTCTTGGCT
TTTANNCGNATTTACAAAAAANAACCATTNTGGTNGCNTTCCCATNGATTTTTGGGNAAT
NCTNGCCAAAGTTGGGNGGACCACCGGATNCTAAAAATCNTTANGAAANAACCCCGCGNC
NAAAGAACCCCNTTTTTGNNGGGGNCCCNGTTTTTAGGGANGGGGCANCCCCTTCCCANN
TTTTTTCCCTTTTTGNNCCNATTANATTCCCNGAAGNGCCTNCCNTGGGCCATAAANANC
NNNCNGANTNNGGGANGTTATTTTNTAAAGAGCCCCCCGNNGTCAATNCNTCNANGNCAN
CCTGNNTTTGNCCCTTNGNNncncnctcttctccnggggaanggncncctttnttttttn
ctnnttnaanggtggaggcntttnannctcccctagcccnnnttttngggnnnnnnnnnn
nnnnnnnnnnnnnnnnntnntnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnntnnnnnn
nnnnnnntnnnnnnnnnnnnntnnnnnnnnnnntnnnaan

Library Name / Clone Name np / np08245_0711
Strand Minus
Insertion Point 6702169
Chromosome Band 2R
Flanking Sequence
ATGGGGGNNNANNGNNNTNTTNNGTTTTTTNTTTTTTAGTNCTCCACACNGGGTGTTCAT
ATNACCCCTNCAACTTGGGNCTNNCGGNAAAGACTCTCGGCTATTNGACGGGNACCACCT
TTTNTTATTTCATCATGAACCCACCAAAAAATTTTAACAGCTGATTGGTTTGGGAGGTAN
AAATTTGAGTGGTTTTTAGGGGGATGGTGCATGTCTCGTCTGGAAAATGCACCTCCCTCT
ACCGAATTTTGTGATTTACTTTNTGTTTAGAATAACTCACTGCTACAGGCAAGAGAGGGG
TGGNTGGAAGTTCTGGAGGGGCCAGTAACAAACAAAGCATTGTTTTGATTGATATTCGTG
CAATGGCTTTGATGGAATTTGCATTTCTTTCAATTTGCTACTTAATCGCTTCAATCAAAG
CAAAAAAAAAANTTTNTAAAANCAAATCGAAATCATGTNCCACATGANCTNTNTAAGTNG
CCAACAAAAGCTTTTNGTTAAAATTTTNGTTNGNCTTCTNGCTTTNAGCGAATTNACAAA
AATAAACATCATGTAGNCATCACATGATTTTGGNAATGCTGGCANAGTTGGGGGAGCAAC
GGGATCGAAGAATCCATAAGAGAGAACCGNCGCCAAAAAACCCATTATTGTTGGGGNCCG
TTTTCAGGAAGGGCAAGCCATCCGACATGTNATCCTNTTNANACCAATCAAATCCATGAA
GAGCATCCCTGGGCATAAAATCCAACGGAATTGGGGAGTTATCATGATGAGCTGCCGAGT
CAATCGATACAGNCAACTGGctttgaccttngnaccactcttttccgaggaaganggcnc
acttattttatgctggctnaaggtagaggcatatnagnctcactngccnnnnnnnnnnnn
gggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnn


CLOSE