Detailed Information [103563]

Strain Information
DGRC Number 103563
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}shep[NP0231] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}shepNP0231 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 64C10
Map Viewer
Related Genes CG10677 CG32423 Srp54k CG4669
Original Number 231
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0231
NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1777
General Information NP_lines
Lethality semi lethal
Embryonic Expression scattered cells
Larval GFP oenocyte, heart
Larval X-gal sg
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np09075_0727
Strand Plus
Insertion Point 5142309
Chromosome Band 3L
Flanking Sequence
gggcnagggntgttngttttnttgtggggantcaccggggggttnannnncccgtaactt
ggggacnnncggaaaagaccncggctattgacgggaccaccttttgttatttcatcatgT
GCCAGNGCACACAACAAGCGAGAGCCACCAAAAATGCCAAAAATAAAGNTGCCCTCTTTA
TCGCACAACCAAACACTACCACTATTGCAATCACCCGAAATAAAGGCTTAACCTTGGACT
TNATAAGCNCAACCGGCGCTTCGACCTTAAGGCGTGGCAAAGGGGGNGGCGACGGCATAC
GGGGAGAGGGCCGGGTCAGCAGACTTAATCAGTCGTTGCCTCGTNGCTTTCATATCGGAA
TGTATTCCGNGAATGGGGCAAAATTGCACTGNAAAACAACAACTTCTTTCCAGTNTCAAA
AATCTGGAAAAATTTGTAAAAATCGAAGGAATCTCCGCTTCGACTTATAAAAAAGNTCAA
ACTAAATTATTCTTCTTTTTAAGATTGGAAATGTACAAAATCCAACATAAAGGACAGNNG
NTAATTAATTATTAATTNACGAGCCCGTAACAACTTAAATTTCTGNGCAAAAATGAAGTG
TGTGGAGCGANTGNAGCGTATACAANCGNGCATGGGACTACCAGCTCATACCTNAAACAT
ACCTCAGATACAGCAATGATTCAAATGANTCGAGGGCTGACTAATTNAAANGCAGCGCTA
CTTTATTTGATAAGCGCTAACCTAGCTGCAGAAAAAANCGAGAAAAANGNCATANGGNTT
NGNAAAAAGAAAAAACTTTTgaggntnggcntcaaaggttacaaagggnaaagnacaagn
tccgngnnaaccatatttttnngnnntataaggncgnnccaanggaaactaaacaaaacn
aacggaaattcaaacnaanaattcccaaaggnaagggaaanagcngncnnttttttaatt
ngnngaaagaacnnaat


CLOSE