Detailed Information [103574]

Strain Information
DGRC Number 103574
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG34357[NP0270] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}CG34357NP0270 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 82C2
Map Viewer
Related Genes CG12586 HB{}1199
Original Number 270
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0270
y+ [w+] 20 September 2008 YHI. NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1318
General Information NP_lines
Embryonic Expression pns, good driver
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05385_0711
Strand Minus
Insertion Point 377909
Chromosome Band 3R
Flanking Sequence
antntttgngtgcactgaaatttattttttatacttncggtaagncttcggctatcgacg
ggnaccaccttntgttatttcatGCATGTTACCAGGACAAACCTTTTGAGTCGGCGGTAG
TGAAATGGACGTGCTGCCGACAATGACACTAAATACGCCTAATTAGCTGATGGCTCTGCA
ATTCAGAGCAAATAAACAATACTTTTCGTTGGCTTTAATTTAAATGTTTNACCAAATCAA
AATTGCAGTTGAAAACAAAACAGTCCAAGCTGACTTGgatcgaanaatacataanagaga
accgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccga
catgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaa
cggaattgtggagttatcatgatgagctgccgagtcaatcgatacagncaactgnctttg
acctttgntactactctcttccgatgatgatgncgcncttattctatgctgnctcaatgt
tagaggcatatcagnctccactgagctnnnnnnnnnnnnnnnnnnnnnnnnnnnncannn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE