Detailed Information [103580]

Strain Information
DGRC Number 103580
Genotype with FlyBase Link w[*] P{w[+mW.hs]=GawB}Rbp1-like[NP0295] / FM7c
Genotype w* P{w+mW.hs=GawB}Rbp1-likeNP0295 / FM7c
Break points/Insertion Site 11F1
Map Viewer
Related Genes Tim9a Rbp1-like CG32634
Original Number 295
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0295

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 322
General Information NP_lines
Embryonic Expression cns
Larval GFP cns
Larval X-gal ventral edge of pouch, sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05445_0711
Strand Minus
Insertion Point 13115518
Chromosome Band X
Flanking Sequence
tttttgggngcctgaatttanttgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgGCTCCTGCTTTGTGGGTGTGCTCTTTGAAAAACCAAGGAGA
ATTCCCTCGGAATAGCATCAAAACAAACTGGAAAATTGACTTTGGACAAGTCCAGTGGTA
CAACAAATACCAAAAATCCATTACAGAACCGGAGGAGCAGCACCTCCAGCCACATACATA
TTCATACATAATGCCACGCTACCGTGAATGGGATTTAGCCTGCAAAGTTTACGTGGGCAA
TCTGGgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggt
ccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccat
gaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccg
agtcaatcgatacagtcaactgnctttgacctttggtactactctcttccgatgatgatg
tcgcacttattctatgctgtctcaatggtagaggcatatcagtctcactngctccnnntt
nnnnggggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)


CLOSE