Detailed Information [103585]

Strain Information
DGRC Number 103585
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP0319
Genotype y* w*; P{w+mW.hs=GawB}NP0319
Break points/Insertion Site 39A1
Map Viewer
Related Genes betaInt-nu Tirant{}481
Original Number 319
Comments FlyBase Insertion: P{GawB}NP0319
NP line. Received from the National Institute of Genetics.
Cluster id 1278
General Information NP_lines
Embryonic Expression gut, pns subet (ch)
Larval GFP cns + pns
Larval X-gal sg, cns
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np04495_0711
Strand Plus
Insertion Point 21021868
Chromosome Band 2L
Flanking Sequence
ttttgggtgcactgcnnttntntgtatacttncggtagncttcggctatcgacgggnacc
accttatgttatttcatcatgCTCCGCGGGGTTGGTCACAGGNATAGTAAGACCATGGCT
CGGCTGGAAGAATTATACCGCCCGAAGAGAGTAAGAGAGCACTAACTTAAGACCAGTTTT
GACAAATTGAGCCTAACAGTGTGACCAGTAATTTCCTAATAAAATCGTTATTCTGACTTA
TATATTAAATAATTTAAATCTCTATTTTACGTTTNAAATCATAAAANCAATCTGAAAAAC
ACAAGACTAACATTATGCCAACCGATAGTCCTATTCATTGTGTTATTTAATACAAAATTT
TTNTAAGAGAAGACTTGCACTACATGAACAAAATTTTTTTTATTAAATTTGTATAGTTTT
GCTTATGTGTAGCTGTTGGTTTGTTGTTGTTTGCTTTAGACTCTTTTCATATGAAATTCG
TCTTGGTTTATTTTTAGTATTTTTCGGNCCCCTTTACAAGCTCTGGACGGCTACAAAACT
TGTGGCTTCCACATTTTTTAAAGTACAAAATATGTAACCCCCTTTCTCTTACCATTTAAA
ATGGGGAGGCTGGNCNCTATTAANTAATATTTTCTNAATGGGGGATGGGAAATTTTTTTA
AAAACCAGGCTTGGACCNTAAAAAGTTATAACCTTTTAAGGTTTNTTGNATTGGGGGACT
TAAATATGGATTATTNNAAAATNAAANAAAAGAAAATGGGTTCGAAANAATTACTNTATA
NAGAAGNAACCNGNCGGCCCaangaacccattttntggtnggggggtccntttttcaggg
aagggggcaagnccatcccnganatnttctttctttttttnggnccatatcaaatatcta
tgaaanagacatnccctngggnnttaaaananccacgcggaattnggggggttatcnatn
atgaggcnnccngantcatatccttaccanncaantgnttttgacncttngntataactc
ttnttcgcnganangaaaaaaaaaaaat


CLOSE