Detailed Information [103589]

Strain Information
DGRC Number 103589
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0331 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}NP0331 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 99A5
Map Viewer
Related Genes stg CG14506
Original Number 331
Chromosome 3
Comments NP line. Received from the National Institute of Genetics.
Balancer TM6UW23-1
Cluster id 1673
General Information NP_lines
Lethality lethal
Embryonic Expression cns, pns subset (ch)
Larval GFP sg
Larval X-gal wing hinge
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np10085_0727
Strand Minus
Insertion Point 25071434
Chromosome Band 3R
Flanking Sequence
gttttttgnnnngantactngggtgacactgcctttttttgtatacttncggtaagnctt
cggctatcgacgggnaccaccttatgttatttcatcatgGTTGACATCATGATTTTCCAC
GTGTTTGCTACTGTTAGTAGTAGTTTATCTAGCTTAAgatcgaagaatacataagagaga
accgtcgccaaagaacccattattgttggggtccgttttcaggaagggcaagccatccga
catgtcatcctcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaa
cggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttg
acctttgttactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgt
tagaggcatatcagtctccactgagcatntttttttttnggnnnnnnnnnnnnnnnnngn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnna
aaaaaaaaan

Image Files
Disc

d1 (->Large)

d2 (->Large)


CLOSE