Detailed Information [103590]

Strain Information
DGRC Number 103590
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}CG42388[NP0334] / FM7c
Genotype y* w* P{w+mW.hs=GawB}CG42388NP0334 / FM7c
Break points/Insertion Site 8C4
Map Viewer
Related Genes CG10962 CG4040
Original Number 334
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0334

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 231
General Information NP_lines
Embryonic Expression sg, a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np52785_0227
Strand Plus
Insertion Point 8788212
Chromosome Band X
Flanking Sequence
gagggcccgnnnngttnngttttttggnnnngancncttggngtcactnaaacctaattt
ttacttncggtaagacttcggctatcgacgggnaccaccttatgttatttcatcatgGTG
TGTCCCATAAATCGAACAGCCGTCAAAGATGAACCACCTGCGGGTGCACAAATTCAAGCT
GGGCGGCAAAGATAATGCCGCCATGGCCGATTTGCCCCAATCGGAAAACACCACCAACAA
TAACAATAATATCGGAAGCAATAATAATCAAAAAGGCGGTGCAAAAGGATTTCTGGGAAG
GATTAAGCGCTACTCAGTGTTGGGAAATAAACTGGGACGTCGTAATCTCGGCAGTATGAA
TCTGAATCCGCCGAATAATGTCGTTGATAATTCCGTTTCGCCCACTAAACTCCATACTGG
AAGCTACAATATGACCGGTAGCCATTCCGATgatcgaagaatacataagagagaaccgtc
gccaaagaacccattattgttggggtccgttntcaggaagggcaagccatccnacatgtc
atcctnttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaat
tgtggagttatnatgatgagctgccgagtcaatcgatacagtcaactgtctttgaccttt
gntactactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagagg
catatcagtctccactgagntnnntttttttnngnnnnnnnnnnnnnnnnnnannnnnnn
nnnnnntttnnnntgggnnttnnnnnnnnnnnngnnngnnnnnnnnnnnnnnnnnngngn
cncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnncn


CLOSE