Detailed Information [103591]

Strain Information
DGRC Number 103591
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0345 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}NP0345 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 65F5
Map Viewer
Related Genes CG14834 CG8596
Original Number 345
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0345

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1806
General Information NP_lines
Embryonic Expression muscle subset, sg
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np39185_0907
Strand Minus
Insertion Point 7304757
Chromosome Band 3L
Flanking Sequence
aggnnngnngtgntangttttttgnnggnannnttggggcannacntttttgtgtacttc
ggtaagcttcggctatcgacgggnaccaccttatgttatttcatcatgCGTCGTCCGATT
TGTTGGCAACAGGCGCTGCCGCGTCAGTTCAGTTCAGTCCGTCGCGTTCGTTCATCTCCA
GTGGTCGTCGCTGTTCCGCTGCAACAGGTAGTTAAAAAGACATAGCCCGATTGGTAAAAG
GTGCATTACCCGCTGGAAGCCCCACAAATAGGATGCGCGCGGTAGGGGGGTGCCCTTGAG
TTCTAGATGCACAGAAAGATACATGCACGTAGATACAGATACAGATACAGATATAGCCAT
TGGCAGAGGGAGAAAAGCGCTTTCTTTGCGTTTGGTTAAATATTACAAAAATCGAGTGAG
AGGAAGCGGGAGAGCGAGAGTGAGACAAAGAAAGAGTAATTTAAAAAAAAACAAAGAGNG
CATGGTTCCATTTAATTTACATAGNTTTGCTTCAGGGGNGNGACGAAAAACAAAATACCA
CTTANTAAGCTAAGTAATTTGAAAATCAAAGCAAGGNGGGCAAANGCAAAGTNGCTTAAC
CAAAAAAACAATNGGCAGNCCAAGGTCGNNGNATCCTTNGNNAGNACCGGNNNCCAANAA
CCCATTTNTGGNGGGGGTCCGTTTTNAGGAAGGGNAAGNCNTNCNAAATNTNNTCTTTTT
NGACCCATNAAATNCTTNNNGNGNCTTCCCNGGGNCTTNAAANNCAANNGGAATTNNGGG
GNNTTTTNNNGNNGANGCTNgccnngnnaatnnnnnaannnnaaannggntttggncctt
tggnacnncnnnntnttccnnannanannggnnnnnctttntnnttngnnggnnnnaang
gnnnnagggnntnnnaanncncactgagcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnan


CLOSE