Detailed Information [103595]

Strain Information
DGRC Number 103595
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}l(3)mbn[NP0355] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype w*; P{w+mW.hs=GawB}l(3)mbnNP0355 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 65A6
Map Viewer
Related Genes l(3)mbn CG18779 Ets65A
Original Number 355
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP0355

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1790
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP epi
Larval X-gal sg, epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05475_0711
Strand Plus
Insertion Point 6084803
Chromosome Band 3L
Flanking Sequence
atttttggngcactgaatttaagtntatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgAACCGGATGTTCAATGGCCGATAAACCGGCGGTGAAGCCT
TNTCGACCACGCCCACATTGTAGTCgatcgaagaatacataagagagaaccgtcgccaaa
gaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctc
ttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtgga
gttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttact
actctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatc
agtctccactgagccatnttntttttggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnaaaaaaaaaaaan


CLOSE