Detailed Information [103596]

Strain Information
DGRC Number 103596
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}kermit[NP0358] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}kermitNP0358 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 44B7
Map Viewer
Related Genes l(2)02045 CG30374
Original Number 358
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0358

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 590
General Information NP_lines
Lethality lethal
Embryonic Expression weak stripe
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np08385_0711
Strand Minus
Insertion Point 3213186
Chromosome Band 2R
Flanking Sequence
tttttggtgcactgaatttaantgtatacttcggtaagcttcggctatcgacgggcacca
ccttatgttatttcatcatgTCAGTGCCTTTGCCCACAAAATGTTGACTTTTCGAATTAA
GTTTCACCGTTAGCAAAgatcgaagaatacataagagagaaccgtcgccaaagaacccat
tattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagacc
aatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcat
gatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgttactactctctt
ccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctcca
ctgagcatctttttttttggggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaaaaaaaaaaaaaaaan


CLOSE