Detailed Information [103602]

Strain Information
DGRC Number 103602
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG8080[NP0380] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype w*; P{w+mW.hs=GawB}CG8080NP0380 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 45A2
Map Viewer
Related Genes Dbp45A CG13741 CG8078 CG8080
Original Number 380
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0380
Balancer CyUW14
Cluster id 615
General Information NP_lines
Lethality semi lethal
Embryonic Expression sg
Larval X-gal sg, mt, epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np39265_0907
Strand Minus
Insertion Point 4153576
Chromosome Band 2R
Flanking Sequence
actnctttgggtgcactgacnttatttgtatacttncggtaagcttcggctatcgacggg
accaccttatgttatttcatcatgCCGGAGACGAACAGAGTAATAATCAGTTAATCTGCC
AAGCACCCAGAGAGCGGACGTGAAAATgatcgaagaatacataagagagaaccgtcgcca
aagaacccattattgttggggtccgttttcaggaagggcaagccatccgacatgtcatcc
tcttcagaccaatcaaatccatgaagagcatccctgggcataaaatccaacggaattgtg
gagttatcatgatgagctgccgagtcaatcgatacagtcaactgtctttgacctttgtta
ctactctcttccgatgatgatgtcgcacttattctatgctgtctcaatgttagaggcata
tcagtctccactgaagccatctttntttttggannnnnnnnnctnnnngatnaaaaaagn
nnnnnccnnangtnnatgctgnnntnnntgttncgaagcctatnatggctcaactggagg
cnatntnacncnccctnanctntntgngnnnnnngnnnnccnnctncattatnanncctt
angnatgngctggantnaanctaatnccntntnaccnnatnnnnnnnnnnnnnnnnnnnn
nncnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
annnnnnnnnnnnnnnnnnnntnnttnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)


CLOSE