Detailed Information [103605]

Strain Information
DGRC Number 103605
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP0395 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP0395 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 88F3
Map Viewer
Related Genes CG14867 CG6136
Original Number 395
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0395

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1499
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP cns + pns
Larval X-gal sg, epi, gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np06115_0711
Strand Minus
Insertion Point 11200471
Chromosome Band 3R
Flanking Sequence
NGGGGCCNNGNNNTGNTANGTTTTTTTNGGNNNGNACTAAACCNGGNGGTTCAAAAACCC
CNTTTTTTTGTGACTTNCGGTAAAGACTCNCGGCTATNCGNACGGGNACCACCTTTTGTT
ATTTCATNCATGGTGCCCACTATTCAGTGTGCGGGGNAATCGATTTTTCTGCCAAATGAC
ACTGAAAAACGGGCAATTCTCTCCCGCTCTCAGAAGGACTCCTTTGGGGTTGCAACTGGG
TAAATTTCTGCTCAGGGCCTGTTATTGGGGGTTTACTATTACTTTTGGCTGTTATCCGTT
AACAGCGCTGTCCTCTGTTAACGACATGTGCGTGTAAATCTGAGATTTTGATTTCAGTTT
ACCAATCTCTGATTTTCGAAATCAATTCTCGGGTAATATAAAACAATTATTTCCACATCA
TACCACACCTAATACTATAAATTATAAAGTAATTTTACGTAAATTGGTTAAATATGAAAC
ACTCTTTTCAATTTTGGAATATAAATACATTTATTTGTCGTTTTCTTTTCGCTATGTCTA
CATTATGAGTTTGTTGCCGTTCTTTTACTTTTGCTTAGTGTTCGATTTTCATATAACATT
TTATTAATTAAAATAATTTTTTCTCCATCCTGTTGATAGTGCTGTCGGCCACTAATGTCT
TTCGCTTTCGCAGTTTTCAAATAGAACATATCATTAAGTAAAAGATTATTATGTATAGGG
GTTAAATTTCAAACTCTAACAATTAAAAACAGTTAAAAATTTAAGTGTTCCGNTAATGGT
TTTGGTTGTCATCTCCCCGNagtacatacatttcctgtttctcgntttttttcccctaat
ttaaatttattcggaggcgcttnttctaaacaaaacaaactagccgatgttggttggtna
cagaaaaggatggatttttacaataaatgggaaacgaaaaaaaacttttgccacatnggc
cggntccanaanaggggcnactanttaaan


CLOSE