Detailed Information [103608]

Strain Information
DGRC Number 103608
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP0404 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP0404 / FM7c
Break points/Insertion Site 15D6
Map Viewer
Related Genes CG8949 pogo{}146
Original Number 404
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0404

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 401
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np52395_0227
Strand Minus
Insertion Point 16794485
Chromosome Band X
Flanking Sequence
tgaattaagtgtctncttcggtaagcttcggctctcgacgggaccaccttatgttatttc
atcatgGTCCAAATCAAGTGTGGGATAAGTGCGAATGAACTGTTTATGCTGATGCTGATT
CTAAAGAAATATGTTTTCGTTTTCGCACTGGCCTAAGAAAACAGTAAGTCTAACGAGCGA
AAATACATTTTAATTTTATGGAAATTATACAAACGTTATTATTTTTATGGGATTATTATT
CTGTCATCATTGGNGGTGGTGGTTTATATTACATATATGTATATGAGTCACAGCTNATTA
AATTNGAGTGTTTTNGGCTATTTAGGAAATGGGAATACGATTCAATCTTAAAATCCAAAA
CTGGCAGATTGTACCGGTAATCGAAATAGTTCTTGCAATATTTCCTTATCCACTTCCCAT
ATCGGATTTCTAATCCTTCAAATAATGGGGTTTTTCCTCGGAGAACCCAGGTNGGGTTTG
GCCAAGCATTNACCCTTANTCTAAGATGGNNTNNATNGGTTTTTTTTTNNCTGNGCCGAA
NCTNNCCCNNNAANGGTTGGTTTGNCCNCCCGCCTTCTNNCACNNTTTTTNCCCCAAACC
CCCNATNTTTCCGGCAANCGGGNCCGGGCNNNNGNATCCCCCANCNNNNNNNTCNGNNAN
NNCCCCCCCCCTTTTNNNNTTTNGGGNGTCCNCCCNAANNANTGNNNNTTNNNNCCCNGN
GTNTNTCTCCNNCCCTNTNNATCCCCTGNTTNNTAANGNTNNTNTNNCCNNNTTTTNGNG
NGNNTCCNNNNCGGNNNCCCcttnnccccccctnttttnnntntttntantnnncncnan
tnncncanncccccccancnatnncnntnnnnnttcntnncccngtctccttnngnnncc
cntncccccatatannnnttnttgnnntnggcnncccnctacnncccncncccncccnnn
tttttnac


CLOSE