Detailed Information [103631]

Strain Information
DGRC Number 103631
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG31957[NP0516] / CyO
Genotype w*; P{w+mW.hs=GawB}CG31957NP0516 / CyO
Break points/Insertion Site 24C8
Map Viewer
Related Genes CG31957 capu CG3980
Original Number 516
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0516

NP line. Received from the National Institute of Genetics.

Balancer CyO;TM3 Ser
Cluster id 1028
General Information NP_lines
Embryonic Expression weak
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np05585_0711
Strand Minus
Insertion Point 3864757
Chromosome Band 2L
Flanking Sequence
gtaaangtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgGACGAAACGTTCCTTGGTGAGTGGAGAATAAAGTCGAGGAA
AACTCCATGGTTAGTTAATTTTGAAATAGCCATTGCCGGGTATACTAGATTCTTTGGAAA
GTATGTCACAGGCAGAAGGAAGCGATGGAACCATACCAAGTAAATATATTCTTGTCCAGg
atcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttt
tcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagag
catccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaa
tcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcac
ttattctatgctgtctcaatgttagaggcatatcagtctccactgaagccatnttttttt
tgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnn


CLOSE