Detailed Information [103634]

Strain Information
DGRC Number 103634
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}rpr[NP0520] / TM3, Ser[1]
Genotype w*; P{w+mW.hs=GawB}rprNP0520 / TM3, Ser1
Break points/Insertion Site 75C6
Map Viewer
Related Genes skl rpr
Original Number 520
Chromosome 3
Comments FlyBase Insertion: P{GawB}rpr[NP0520]

NP line. Received from the National Institute of Genetics.

Also known as P{GawB}NP0520
Balancer TM3 Ser
Cluster id 1967
General Information NP_lines
Lethality semi lethal
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal margin
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np10455_0727
Strand Minus
Insertion Point 18347407
Chromosome Band 3L
Flanking Sequence
ttttnngtgcactgantttaattgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgGCCACCACCAGAAAAACAGAGAACAAGGCGGCGTGAGAGAA
CCAGGTATAAATAGCCTCGGAGCACTACTCAATATATTCAGTTGAAAAGCAACCATCGCA
GCGAACGCATCTCGAAAAAATCATTGAATAAGAGAGACACCAGAACAAAGTGAACGAACT
CGAAAATACGAAAGAAAAGTGTGTGCGCCAGCAACAAAGAACTAACTCGATAAATATTCA
TTGTGCAGAAGAGAAAGTTATTGAGTCACTACCAGTTGTGTAATTCCGAACGAGAAGAAA
GATAAACCAACAATGGCAGTGGCATTCTACATACCCGATCGANGAATNCATAAGAGAGAA
CCGTCGCCAAAGAACCCATTATTGTTGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGAC
ATGTCATNCTCTTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAAC
GGAATTGTGGAGTTATCATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGA
CCTTTGTTACTACTCTCTTNCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTT
AGAGGCATATCAGTCTCCNNGCNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnn

Image Files
Disc

d1 (->Large)

d2 (->Large)

d3 (->Large)


CLOSE