Detailed Information [103636]

Strain Information
DGRC Number 103636
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP0522 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP0522 / FM7c
Break points/Insertion Site 12C1
Map Viewer
Related Genes rdgB Yp3
Original Number 522
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0522

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 331
General Information NP_lines
Embryonic Expression sg, small # of cells
Larval GFP cns + pns
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np41135_0907
Strand Plus
Insertion Point 13492740
Chromosome Band X
Flanking Sequence
anngnttttttnggaggccactgtntaataantgtatactttcggtaagcttccggctat
cgacgggaccnccttatgttatttcatcatgGGCTTGGTAAGCTCTTGCTCTNGCTGCTT
TTCTCCAGAAGAGAGCGCACAAGGACGCCGGGACGTTGGCATTTNGTGGGGTTCTGGCCA
TCCGAGTTTCTTGCAGAAATTACTGTATATTATTCATTGGCCGATATGCATAAATCCAAT
TTACGAAACCCCCCCTTTTCAGCCTAGCCAGCTGAGTGTCCCCGCAAAAGGAGAGAAAGG
CAAAGAGAGTGAGAGTGACGCTTTCTCGCGCGCTTTTGTTGCGCACAAATAAAGTAAGGG
GTTTTCCGCGAATCGTCAGTTGAGAATTGAGAACTGAACTGACCGTTTTCAGAAACGGTG
GCGTTTTAACTTTTTTGTTATTTAATTAGTCCTTAAATAGTCCTTTTCTAAAATGTACTT
AAAACATGTNTGTATATGTAATGTAGAAATAGTTTTTTTAATATCTAAGCAAAAATTATC
CANATTGCANATATGTACATACATACATATGTATTTTATGTATATACTAGCANACTTTTN
TATGAGTCTGGCGATTTTGCGGTGATACTCATTTTCGGAACGCCCTCGCTCTCTCCGNTC
ATTTCTCTTGGCTTTGCTTTTTGCTTTAGCTTTCNTTTGGCTTTTCCGGCGGTTTCGTNC
ACGTTNAGCCGTTCGGCNTTTCCCTTTCAGTTTCATTTCCGGNTNGGGTTTATCCTNACN
TTCANTTTGNGGAATTAAAAccgcgnngcccgagtttcnacaattcgtaaaccttttgcc
cncccgcgntnacgncacgccttgtttttnttcttnancgtnggntnccnctntttnaat
tggcnaaacagnaaaatnattcccaaccccnangggcnaagcccgnnaccancngcttgt
aaaaanatttnttttccnccttt

Image Files
Disc

d1 (->Large)


CLOSE