Detailed Information [103731]
 

Strain Information
DGRC Number 103731
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}NP0731 / CyO
w*; P{w+mW.hs=GawB}NP0731 / CyO
Break points/Insertion Site 48A1
Map Viewer
Related Genes tou en
Original Number 731
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0731

NP line. Received from the National Institute of Genetics.

Balancer CyO
Cluster id 684
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression en-trap? P comp. of epi,
Larval X-gal P comp. of discs, mt
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np10175_0727
Strand Minus
Insertion Point 6637161
Chromosome Band 2R
Flanking Sequence
acttnttgggggaaaaaaccccctttttggntacttcggaaagccttcggctatcgacgg
gaccaccttatgttatttcatcatgGGTTCAACAGCGACTGACTGCCGCGCTCTCTGCAG
AGTGGCGAGTCGATTAGTCGATAAGTTTCTCGATAATATTTGTATGTTAAGGATGGGTGT
ATGAGTGTATAAGCTTATGACTAGATTGGCTATGTATAATTNNNTTTGTATGACTAAGAG
TAAAGGAAGAGGGTAGAAGGAGCAGCCTACTACATAACTTTAATAAACTTATCCGAATTA
GAAAGAAAAAGTTGTTTATCCATAAAAAGAATATATATATTCTTTTCGTTCTGNGCTATT
TAAAATCTGGTTTCACATACAACGCAGATTATTAATATTTATGAACCTTAAATAAATGGA
GTTTTCCACCCTCGTTNCTTAATTTTCCCACCCTGGGAAACACAGGCGAGGGGTTTTCTN
CTGGGNCATTCACTAAANACCGATTTCCNGCTGGCACTCAACAATCGGTNAATGCCTGNG
AGCCCCCCCCCCTGGAAAAGCANAAAAGNCATTGGGTTNATCAACTTACCNGGCTTACCT
NACAGGTTACTNCCTAACCNGGTTNACCTGGCCTACCTACCAGGCNGNTTACCNCTTAAA
AAGCTGGGCNAACNGGGANAAAAAAAAATTTGGCCCTCCAANCTAGGNGGGCNNTAAAAG
GGGGGGGAGGCCCCCCAAAATCGGNCNGGNAANGCCCCANTCNAAAAAACCCAAAAAAGA
AACCCGNCCCCAAAAACCCCaattttgggggggggccccttttaagaaanggcnanccct
ccccnntngtatttcnttttaaaacaaaaaaaancaaanaaaacncccnggnnanaaaaa
ccacgggatgggggggtttnntntgagnggggnncggaaaaaaaaaaaaaaaanggtttn
anccctnnnccccccccttnccggagagggcccccttttntt

CLOSE