Detailed Information [103782]

Strain Information
DGRC Number 103782
Genotype with FlyBase Link w[*]; P{w[+mW.hs]=GawB}CG8237[NP0836] / CyO
Genotype w*; P{w+mW.hs=GawB}CG8237NP0836 / CyO
Break points/Insertion Site 44F8
Map Viewer
Related Genes CG8235 CG8237 CG8243
Original Number 836
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP0836

NP line. Received from the National Institute of Genetics.

Balancer CyO;TM3 Ser
Cluster id 610
General Information NP_lines
Embryonic Expression sg
Larval X-gal sg
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np09525_0727
Strand Plus
Insertion Point 3986441
Chromosome Band 2R
Flanking Sequence
gccttntttgtgtgcttcggaagcttcggcttcgacgggaccaccttatgttatttATCA
TGAACTTGTATAAATAAATAAAAGCCAGCCAAATAACAAAATCNNtcgaagaatacataa
gagagaaccgncgccaaagaacccattattgttggggtccgttttcaggaagggcaagcc
atccgacatgtcatnctnttnagaccaatcaaatccatgaagagcatcccctgggcataa
aatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatacagtcaact
gtctttgacctttggtactactctctttcgnngatgatgtcgcacttattctatgctggc
tnaatggtagaggcatatcagtctccactgaagccatcttntntgggaaaanttnnnnng
gncttgggggattttgggccaagnggcccnnntggannttantccagggnnttggggggt
nccannnccntctgnncccttttggnannncccccnggngggnancnttnnatnntnann
ccttttnattnggnaaatcnttntttccnttgggggggnnancnngnnaannnaaagntn
ngtgngggncnggttnnggnccccccnggnnccaaaaaaancnttttttnganntttttt
gnncnnntncnttnntttttttttnnnggcccccnccccnntnntnannnnnaaggngnc
cannnnnnngnttggtntntnnaangngtggggnnnntcccntnccnnnggggnnnncnc
nggnangnnnnnnnnnnaaaancccnntntnttttnggnnnnnnggnntccntntntngg
gngccccccttnnnnnnntnnnnnctnnccnnnngggggcccngngggnnntttttttnn
ccncnaannnccnngnnnggnnnntttnncnggngan

Library Name / Clone Name np / np10775_0727
Strand Plus
Insertion Point 3986447
Chromosome Band 2R
Flanking Sequence
attcttgggtgcactgnctttntttgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgAACTTGTATAAATAAATAAAAGCCAGCCAAATAACAAAA
TCgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtccg
ttttcaggaagggcaagccatccgacatgtcatcctttttngaccaatcaaatccatgaa
gagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagt
caatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcg
cacttattctatgctgtctcaatgttagaggcatatcagtctccactgaagccatcttnt
tttttgggnnnnnnnnnnnnnnnnnnngnnnnnnntnngnncnangnnnnnccnnnnnnn
nnnntnntncnnnnnnnnnnggnnngnnncnnnnnnncnnnnntgnnnnnnntnnnnnnn
nnnnnnnnncnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE