Detailed Information [103838]

Strain Information
DGRC Number 103838
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}e(y)3[NP0968] / FM7c
Genotype y* w* P{w+mW.hs=GawB}e(y)3NP0968 / FM7c
Break points/Insertion Site 18D10; -; 18D11
Map Viewer
Related Genes CG12238 CG14212 CG14213
Original Number 968
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP0968

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 456
General Information NP_lines
Embryonic Expression visceral mesoderm
Larval X-gal sg, DT
Genus Drosophila
Subgenus Sophophora
Species Group melanooaster
Species Subgroup melanogaster
Species melanogaster
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np39905_0907
Strand Minus
Insertion Point 19368313
Chromosome Band X
Flanking Sequence
tgaattaantgatcttcggtaagcttcggctatcgacgggaccccttatgttatttcatc
atgGGCCAGGGCAACCAACCCATATGAGTGTGTGCGTGTCGTGCTCCTTCGTATGTGTGT
GTGTGTGTGTGGATTTTCTCCATGCAGCGGCATCGACTGCTTGNGGTGGATTTGGCCGCC
AGCGTGGNGAATTCGCGTCAGTGTTGCCAGCACACACCAGTAACAAACAGGCCATAATTC
GNGGCGGCGCGGCTTTCTCAGTATTTGCCTATCCCGCTGCTTCGNTGCGCTCCTNTGCGC
TCAACGCCATAGCCAATCCGCTTNATTCTCATNTTTCTCCTGCCTTTTCACGGTCTCCCC
CANNCNANANNTGTGTGCCCATGTTTTGCAGCGCCTTATTATTTATAAAGGGGNGGGNGN
NGGNGNCCCNCNCCCGGGGGTTTTTTTTTGGGGTTATTTTCNCTTGAANGTTTTTCNNGN
GAATTTCGAGCGGGNGGTTTTTTNANCGCCGGGAAAANACNTTTTGGTTTTTTTTNNGGG
AATTTTTNGGGGGGGGGGAANNGTTNAAACCCCCCNCCCCCCCNTTNNGNTTTTAAAAAA
ANCCGGGTNTATTTTTTTTNAAAAAACNGGCCTTTAAATAANNGGGGNAAANCTNNCCCC
CGGNTTTNAANAAAAAAANNTTTTTTTTTTTTNGGGGCCCCAAAAAANGGGGGGGGNCNC
CNAAAAAACCCNANAATTTTTTTTTTTNTTNTTNNAANGNNNTTNGGGGGGGGGGGNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnntnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnn


CLOSE