Detailed Information [103854]

Strain Information
DGRC Number 103854
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}pigs[NP1005] / FM7c
Genotype y* w* P{w+mW.hs=GawB}pigsNP1005 / FM7c
Break points/Insertion Site 6C1
Map Viewer
Related Genes CG14444 CG3973 Burdock{}74
Original Number 1005
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1005

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 180
General Information NP_lines
Embryonic Expression scattered cells (SG)
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03015_0711
Strand Minus
Insertion Point 6342216
Chromosome Band X
Flanking Sequence
ancnttgggtgcctgcnntttntgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgAGCGGNAGCTCANANGANAGAGNNATGCGGNTAGCTGTGGG
AGGAGAGGCGCATGCATCNCGACCGTTATACTNGACGGGAAGAACATNTGGAGGCCCNAN
NNACNTGNNCGAACTAAAACNNNANACCCCNGNCTTCTTAACTNNNCACCNGCNNANTTA
NTNTTGTGGNTCANGGGAGGATTAAGTGCGAGGNCATAAGGTATCNTCACCCTAAGATCA
GGTGAGNNTATGCATATTAACANTCTTTNCATCTACAGCGTCTGCCTCTGGGAACCACAA
TCCANATNTNAAAANANAAAANAGNGNACCGNGGNCAANGANCNCATNATTGTTGGGGTT
CAAANTNANGAAGGGNATGCCNTCTCGACATGTNCATGCTGTNACACNCANCCCANNTNC
ATGANGAGCATCCCNGGNNATAAAAANCAACNNTTTTGCNGAGATATTATNATGAGGCNG
CCGAGTTAATNCNAATACNNNCNNCCGNCTTTGAANNTTGTTANNACTNATTTTNTNATG
AAANATNGGGNACATATTCTGNGCTGTCNCAGGGGGNNNAGGCCTGANANACNCCNCTGA
GNCAAAAAAAAGAGGGGGGGNGGNNNTCNGNAAAAACCNTAANANNAAACNCNGNCCCCA
AANAACCCTTTTTTGGNGGGGGNCCCCNTTTTCAGGAAGGGNGNACCCCTNCCNNNNNNN
TTCCTTTTTTNNCNCCAATNaattcnnnngngagcnncccngggntaaaaacncccgnan
tnggggggtttanaggnagngncnnngnaaananaaanannaanggntttgnccttnnnn
nnncncttctccggggagaggcnn

Library Name / Clone Name np / np54223_0309
Strand Plus
Insertion Point 6342209
Chromosome Band X
Flanking Sequence
ccacctgntnggaaannancccccntnttacgntaagtggaangnccncttgccgacggg
accaccttatgttatttcatcatgCTCCCGNTCTTTCCCCTACCCTATCCCTTTACCACT
CGCACTCACGCACACTGGCGCAGAGATAGCGGTTATGGGATTACAATAATTTCCAGAAAT
CAATGCACAGTGTGGTAGCCACGCAAACGCATAAATACATGTNTTTTTNNTGTTTGCTTT
AACTGCGAGTTNATTGATTAACTATAATAATAATGATGATCCTCTAGCTAGAGGCTTTGG
NCACTAGTGGATCTGGAACCTNNAGCTAGAGCTNTGANNNCNNNTAANTAATANTATGAG
NNAATNCAAACCCCACGGNCATGCTNAGGGNNANNCNNNNNNNNNNNNNNNNNNNNCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnanaaaaaa
g


CLOSE