Detailed Information [103860]

Strain Information
DGRC Number 103860
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP1033 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP1033 / FM7c
Break points/Insertion Site 15A1
Map Viewer
Related Genes CG4678 CG9699 Axs
Original Number 1033
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1033

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 395
General Information NP_lines
Embryonic Expression muscle subset, dorsal vessel (SG)
Larval GFP cns + pns
Larval X-gal cns
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17185_0807
Strand Plus
Insertion Point 16426119
Chromosome Band X
Flanking Sequence
ACTTCTTTTGGGGTAAAAAAACCCCCTTTTTGGGGNCNNNNTAAAANCCCTCNGCTTTNG
NCGGNACCNTTTTTTGTTATNNNATTTTGGNTNTGCTCTTCCTTTCCAAAAACATTCGAA
CCGAAAATACCAGCAAAAATACCGAACAAATAATACTGCTGGATGAAAGGGTCTTACTTT
GCGCCATTTCACTTCAACAACTTTATTCAAACTTGANNNTTTNAAAGTACATTTGAACAA
GAATAAAATTTGTTAAAAATAAGAATGGTATTTAATATGAGTCCATAATAATAATGATAT
GAGTGCCATTATCTCAAAAACTAGGTAAACATTTTTTATGGCAACTACATTTTTCCTGAA
ATGTCCCTTAAAGAAAATGTCCTACGAGTGGAGATATACCCCAAAGAGTGGGGGAGTCGA
TTTTTCTCTAAACTTAGGTCGAACATAGATAGTTAGATCGAAGAATACATAAGAGAGAAC
CGNCGCCAAAGAACCCATTATTGGTGGGGGTCCGTTTTCAGGAAGGGCAAGCCATCCGAC
ATGTCATNCTCTTCAGACCAATCAAATCCATGAAGAGCATNCCTGGGCATAAAATCCACC
GGAATTGGGGAGNTATCATGATGAGCTGNCGAGTCAATCGATACAGNCAACTGNCTTTGA
CCTTTGGTACTACTCTCTTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGGT
AGAGGCATATCAGTCTCCACTGAGCTCNTTTTTTTNNGGGGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE