Detailed Information [103863]

Strain Information
DGRC Number 103863
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}NP1039 / FM7c
Genotype y* w* P{w+mW.hs=GawB}NP1039 / FM7c
Break points/Insertion Site 18B1
Map Viewer
Related Genes Ulp1 CG7990
Original Number 1039
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1039

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:18B4
Balancer FM7c
Cluster id 441
General Information NP_lines
Embryonic Expression pns large subset (TU)
Larval GFP cns + pns
Larval X-gal sg, cns
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np19595_0807
Flanking Sequence
GGNGGGNGGGNNNGNNNNNGGGGNNNNGGGNNGGNNNNNNGNTNTNTTTNANNNNAANAN
AACTGGGGGGGGACAAAAAAACNCTTTNTNGGGNGACCNNNGGAAAAGCCCCCGGGCTAT
CGNAGGGGACCACTTTNAGGGNAANNNNANCAAGGAACCAGNGNGGGGAAANNNAAGGGN
NNGNNNGGGCCNGGGCCAAAAAANAAANAACNNNNAAGCGGGAGGGCAAGCGCACGCNNA
AGNGACACCNCCCAAANCCCANCCNNCCNACCNNAANAAGNCCANCAACCAANCAAACCC
AATTNTANTNTCGGNCGGNNGGNNANGNAAAAANGCGGNGGGGGGNNGGGCGCAACAAAC
AAANCNGGNGGNGGNGGANCCGGGGNGNNANCANGGNGGNGGNGGNGGGGGGGGGGGNAG
AAAACGGNNNNNAANNNGNNAANAAGGNCNNCCNNNNNNGGGNNNNNGNGGGGNNGGAAA
NNNNANNCCGNAAGNNAGGNNNNAGNNAGGGNCNANNCNANNNGGGNAACNCNNNNNNNN
GNGGGNNNNGNANAAANNNNNNNNNNAANANNNGNAAAAGGGNNNNNAAAAAGGNGGNNN
AGNNAANNNNAANAAANNGANAAAAAAGNCAAANNNNNNAGGNNGNAANAAAAAANNGGA
AANNNCANANNNNNANNCANAAAAGAANNNNGGGGGGGNNNNNAAAAAAAAANAANGAAA
AAANGNAAAAAAANNNNANAAAANNNCANNGNANNNAANNNNNGNANGGGGGNNAAGGNA
NNANAANNNNAAAAAAAAAAannnnnnnggnnaaaancaanaaaannnnngnnnnnnnaa
aaancnaaaaanaaaannnnnnaccannnnaaagggaaaaagggnggnggnnnnnaanan
aaggggnngnaaaggnggnnngnaaaannnagaanggnnnagggggggnaaannnaaaaa
agnnnanaaaaaagggnnngncgnganaaggaaannngnannnngnaaaaannncnggna
aangnanngnnaaaannggggangaaaaaaaaaanggggaaaaannngnnnngaaaannn
gnaaaaaannggaagggggaaanannnaaanaannnnggananaanngngngaaanaaan
ngggnnnnaagggnaaaaaangnnnnnnggaaaaannggngnaann

Library Name / Clone Name np / np58783_0309
Strand Plus
Insertion Point 18932747
Chromosome Band X
Flanking Sequence
cggggcccgcnngnnngtntttggnnngntnttggtggcataacgcagtttacgttagtg
gnatgtctcttgccgacgggnaccaccttatgttatttcatcatgCCGCGGGCCGTGTTC
CCAGTGGCTGCTTTCTTGCGCGGCCTGGTCGCACTGCCCGTCTGGGGTGGCATGTCCACA
CTGGCGATATACCGTTAGCTTTTGTTATTACCGTTATGCTTTGTTGGCAGGGTCACACTG
ATCCTCTAGCTAGAGCTTNGNGTACTNGCAAATTATTAAAAATAAAACTTTAGAAAATAA
TTTCNTCTAATTAATATTATGAGTTAATTCAAACCNNACGGACATGCTNAAGATTANGAG
ANAATNAAAANNNNNNNNNCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE