Detailed Information [103865]

Strain Information
DGRC Number 103865
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}CG32625[NP1044] / FM7c
Genotype y* w* P{w+mW.hs=GawB}CG32625NP1044 / FM7c
Break points/Insertion Site 12B10
Map Viewer
Related Genes CG10990 Rtc1 CG32625
Original Number 1044
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1044

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 330
General Information NP_lines
Embryonic Expression a small # of cells
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np51355_0227
Strand Minus
Insertion Point 13487244
Chromosome Band X
Flanking Sequence
ggggggcnngnnttngttntgtatttttgggnnngannanccggggggtcaaaanncccg
ancccttngggggncggnaanaanacngctatcgtacgggnaccaccttatgttttttca
tcatgATGTAGGNNATGAATATATATTATATGTATGTAAGCAAATATTANATTCAATTGT
TTATCCCATTTGCAGGAACATATCATCAAGTGCCCGAGCTACTTACGCGAGGAGAGCCAC
AGCGACGCAAAAGAAGATNTNNNGGACTGTGATGCCAAGGAAAGTGATGCCAAGGNCNGG
GATGCCGACCCGCCGGTTTCGACATATGATCNAANAATNCANGGGNGNGAACCNCCNACA
ANGAACCNATTAGCNGGGGGNGNCCGCGNNCAGGAAGGGCAAGGNATCCNACNNGANATA
CGGNTCAGACCANTCAAATCCANGAAGAGCATCACANGGNCATACAATCCAACGGAATAG
GGNAGCAATCATGANNAGCTGCACGNGTAAATNGATACAGACAACTGTCATACGACCTTG
ANAACGNCTCGTNTTTACGATGANGATGGNGCACTNATTNTATGCTGNCGNANTGNNAGA
GGNATATCAGNCTCCACTGAAGCCAATNNNNTNNNGGNNNGNCNNNCNANNNNNNANGAN
NNNNNNNNNNANACNANNCNANNNNNANNNGNNAGNNNNNNNNGGNNANNNNANNNAANN
NAANNNNNNNNGNNNNNNNNNNNNNGNNNNNNNNGNNNNNNNNNNNCNNNNNANNNGNNN
NNNGNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnnnnn
nnnnanngnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnannnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE