Detailed Information [103882]

Strain Information
DGRC Number 103882
Genotype with FlyBase Link y[*] w[*] P{w[+mW.hs]=GawB}tlk[NP1098] / FM7c
Genotype y* w* P{w+mW.hs=GawB}tlkNP1098 / FM7c
Break points/Insertion Site 3E6
Map Viewer
Related Genes Rala FB{}43
Original Number 1098
Chromosome 1
Comments FlyBase Insertion: P{GawB}NP1098

NP line. Received from the National Institute of Genetics.

Balancer FM7c
Cluster id 111
General Information NP_lines
Embryonic Expression sg, a small # of cells (SG)
Larval GFP fb
Larval X-gal gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np19245_0807
Strand Minus
Insertion Point 3468779
Chromosome Band X
Flanking Sequence
atnttttcgtgcactgantttatntgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgAGCCGTACTAATTGGCATACACACATGCCACGCCTCCTA
CTGCTCCTAAGCGCACACACACACACACACACACATACACACATGTGCATAAGTTTTTTT
GAATTGTTACCGGNGCCAATTTGTTTTTGCGAGTGTATTTATTTGAATTTACTTTTATTC
GCGTGAATATGTGTGAGTGCGAGAGAATTAAATCGCCGGCTGAGATAAAATAAAAGTCAC
TACAACAATAACAACAATGCTATTCACTCGCCTCTCGCTCGCACACGCTTCGCTTTTCGT
TTGCTTTGCTTTGCGTTGCCTTTTTTTTCCGTTGTTNCCCCCCCACCCCTCTCCGTTTTT
GCACACAACGCTGCGAGGTTAAGTTTGCGATTTTAGGAATTGTACGATTTCTACGGGTTT
TCCGACATCGACATCACATTTAGAGGAACGAGAGGNGTTNACCATGTCATTNGGNGNGGC
GAGCATATATNTTCCGCTTCCGATCGGATAATACATAAGATANAACCGTNCCCAAAGAAC
CCATTNTTGTTGGGGGTGCGGTTTTAGGAAGGGGAAGGCATCCCCANNTGTNATTCTTTT
CAGNCCAANCAAATCCATGAAGAGCATCCCCTGGNCNTNAAATNCAACGGAATTGGGGGA
GTTANTATTTATNAGGCTGGCCGNGNCAAATCNAAACAGACCACTGGNCTTGGNCCTTNN
GCTTCTACTCTNTTNCCGAGgaggangggnnncttattttatgctgtccnaatggnagng
caaacattctccnccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnn


CLOSE