Detailed Information [103894]
Strain Information
DGRC Number 103894
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}lolal[NP1126] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
y* w*; P{w+mW.hs=GawB}lolalNP1126 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 55B9
Map Viewer
Related Genes CG10914 CG5124 lolal
Original Number 1126
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1126

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 843
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality lethal
Embryonic Expression ventral epi stripe, interesting
Larval GFP tr
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2017-11-23
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]

Library & Clone Information
Library Name / Clone Name np / np03135_0711
Strand Plus
Insertion Point 13220665
Chromosome Band 2R
Flanking Sequence
ntcaacgtgcactgnanttaagtgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgCGCCAGAGCTTAAACTTTAGTCTCACGCTCTCTGTGTCCCT
CGTTCTCTTTCGCTAAGCGCTCTCAACTTTCAACTGCCGTTATGATTTCGCAATTACATT
ACAACAACAACAACTTAAAAGGCAGAGCAGACATCGCTGGAAATTCAGCTGCATAAGTGT
AAGTGTGTGGCTGTGTGCGAGTGTGGGTAGGCGGCGGCAACTATCTCGCTTGCTCTTGCG
CCCGGGGTTATCGGTAGCTTCTTCTAGGCTGAGTGCATTTCGTTGAATCGTGGATGTTGA
AAGTTGTCTAATTTCCGAACTATTGATTTTTCCCCTTCCCCGTCAAGAAACTGCATTGTT
GCTTCTTGAAGACCAGTTTTGGTAACATCAGGAGAATGGAAAGGAGCGAGTGAGTCGGTG
AGTAAGTGAGTGAGCGATGCGAGCGACAAAATCAACAACAACAACAACGGTTCAAAACGA
GTTCCAACGAAAGTTGCAACACTCTCAACAATTTGAGCAGGCTCCGGTTTGTTGGTTATT
TGCATTACTCAATCGGGGAANAAACTCTACACTTCGACCGGAATTAGTGTGCTTCGTCTG
AGAATTATTTCTATTTCAANTTCTTTTNCTTTTGNTTTTTGGGCCAGAACAATNGGCGGT
CNGGCNAACGGTTTCGGTGGGAAAGNCCGCAANGAACCACCGAAAAATGCCCTGGNGNNT
ACCATTTAACCCGAANCCGCcctttggtttatgncaaaatatttatttgggaatatttnt
gggtaaaattnagggcccgccttcggggttactttttatttnttatacccgccagaagca
gccccgcatncagnncccntacncacnntaacaaacggncggtaaaatacnccttggctt
tttttcccncnnctntcccaatatattnatttgggggggcgg

CLOSE