Detailed Information [103902]

Strain Information
DGRC Number 103902
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}CG7220[NP1147] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}CG7220NP1147 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 47B9
Map Viewer
Related Genes CG12338 CG7220
Original Number 1147
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1147

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 666
General Information NP_lines
Embryonic Expression sg
Larval GFP gut
Larval X-gal gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03295_0711
Strand Plus
Insertion Point 5800364
Chromosome Band 2R
Flanking Sequence
atnttancgtgcactgcanttanntgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgCCCTGCAGTCTCTCCCACAATTTTCTGGGCGCTTTCCTG
CAGTCGTCCCACGAACGTTGCCGCAATTGGTCTACACGAATCGGTTCGCTAATAAAATGA
CTGCCATGCCCCACGCCCACTCTCGCCTCCTGGGAAAAACGCTGGCATATTGAACTGTGC
GACTATAACTAACTTTTAAAATTAAATACTTAAAAGCAAGCCCAGCAAGCCGAGAGCAAT
CTGCCTAAAAGTGACAAGTTATAGGGTGACACAACAAAAGCTAAAATTTGTGAGAAACTG
TGTGAAAACTAGAACTACAAAATGATGAAGCTGTTTAAAAAACCCAAAGACAAAATACCC
AAATCGGAGATTTTAACCGAGCCCAAGGAGCCCAAAACACCGCCGGGTCTCCAAGTGCGG
AAAACCTTTGGAGTTGGACAACTCGCGATGGGGAGGGCAAGTATATTCGAGGATATTAAA
CCTGGAACTTTGGCCAGATNTCGCGTTCGAACAACTNGGTCGTCAATATAACATATTAGN
GTTCCCNTTGCATCATGGAGTATGGTAGNTATTTTTGAGGTTTCAAGGAAATTCTGGCGG
TGNATTCTTCTTGTTGGATTNCTTCTTTNAAGGGCTGNACCNAGAATTNGTTTTNTTTTA
TTTCTTGGGCNTTGCCCAAAATCCAAACCCTTANTCGGTCCGAAGAANNCTTAAGNAGAG
GAACCCGGTCGCCAAAGAAAcccatttattgntggggggncccnttttcagggaagggca
aagcccatccgacannttattcctntttngancaatcaaattccctggaagagcctccct
ggcnntaaaatccaccggaattgnggggngtaatcatgaagngcggccggtcaatcgatn
cagnnaantggntttggnccttgtnactactttnttccnagaagaggcgnacttttttnt
gctgn


CLOSE