Detailed Information [103904]

Strain Information
DGRC Number 103904
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}tou[NP1153] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}touNP1153 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 48A3
Map Viewer
Related Genes tou CG9006
Original Number 1153
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1153

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 685
General Information NP_lines
Lethality lethal
Embryonic Expression muscle
Larval GFP tr, mt
Larval X-gal sg, gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np16525_0727
Strand Minus
Insertion Point 6669942
Chromosome Band 2R
Flanking Sequence
anttnttggggnaaaaaacctttttttgnatacttcggtaagcttcggctatcgacggga
ccacnttatgttatttcatcatgCCCCGTCCATTATCCTACCCTTCCCCCTTTGCCCATG
CCCTGTGGGCACGTTCGTTAAATGTTGAATAAATTTTCTCATATAATCGCAGTCGTCGCC
CGTTGCTCTCTGCGGCGGCTCTCTTCCCCCNNTNNNCCGCACCCGCAGCACACTCAACCA
CACATTTTCTCCCTCTCCCAATCAGCAAACAACAACAGCAACAACGCGGTTGTCTCCGCA
GCGTCGTCGGCGTCGCAGCTGGCGTCACAGTCGCTGCCGCCGATGTTGAATGTTTGATGT
TGAATGTTGATGGNGNTAGTTTGGGTCGGAAACTCGTCGGGCGCGCAAGNGGAATGCCCA
GCGAGAGATNATAAATCTAAAACAAATGCTTAGAAAAGNNTGAAAGATATGAAAATATGA
ATGCCAATTCGGTGCGAAATAATTAGAAAAGNGAATGGGGGNNCCAAAATTGGGATTGGG
CCCAAGTNAGAATGCCAATGCCTTAAAGTTACCCATAACCAAAANAAATGGTTTAAAAAA
GNCCCCCAAACAGCAANGGAGNGCCGCCGGNTCCGGNTTGGGGTTCCNCAAGGCTTAAAC
NGGATTCCGTTNGGGCCAAGGTCNGGTGGNTTTTTTTTTTTNCCCCCCCCGGGGTTTTTT
TTTCNNNAACNCAAGCCAAGGGGTGGAAGAAANAAAATGNGGGGGGGGNCCNGGGGGGGG
GGGGGGAAACCCGCCCTTTTttttttggcccttcccccccctttttttttaaaggccttt
ttttnccnaacncccccaaggggggcggggaaaaaagggtttaaaaaaaancccccttgg
ngggaaat


CLOSE