Strain Information | |
---|---|
DGRC Number | 103907 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}mbl[NP1161] / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | y* w*; P{w+mW.hs=GawB}mblNP1161 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | 54B4 |
Map Viewer | |
Related Genes | mm CG33197 jockey{}841 mbl |
Original Number | 1161 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP1161 NP line. Received from the National Institute of Genetics. |
Original Comments | comment1:A, comment2:54B15 |
Balancer | CyUW14 |
Cluster id | 819 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | pns(ch) |
Larval GFP | pns (very clean and specific) |
Larval X-gal | sg |
Adult GFP | internal |
Reference | Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [RRC reference] |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Sugimura K, Satoh D, Estes P, Crews S, Uemura T. Development of morphological diversity of dendrites in Drosophila by the BTB-zinc finger protein abrupt. Neuron (2004) 43(6) 809-22 [PubMed ID = 15363392] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np16545_0727 |
Strand | Plus |
Insertion Point | 12413488 |
Chromosome Band | 2R |
Flanking Sequence | tttagcgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccac cttatgttatttcatcatgGCATGTCCCTGCTACAATTGCCTGTTGCCGTCTCTGTCTTT TCGTCCTgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggg gtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaatcc atgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagctgc cgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgatga tgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgaagcatc tttttttttgggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnn |