Detailed Information [103910]

Strain Information
DGRC Number 103910
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1165 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1165 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 28F1
Map Viewer
Related Genes CG8419 CG8451
Original Number 1165
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1165

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1106
General Information NP_lines
Lethality semi lethal
Embryonic Expression pns (ch)
Larval GFP gut, fb
Larval X-gal sg, gut
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03415_0711
Strand Minus
Insertion Point 8197397
Chromosome Band 2L
Flanking Sequence
tttttngcgtgcactgcanttangtgtatacttcggtaagcttcggctatcgacgggacc
accttatgttatttcatcatgGCCCAGTGGCTTTTATTTTCGACCCGCTCGCAGACATCA
GTTGCAGTTCGGAAGCGGAATCGGTTGATGTTGTTGCTCCGATTCGGACGTGGAATATTT
CGCTTTTGTACACTCGTATTTTCGACTTCAAAGAATCGGGCAAAAGCGCACAGAACAGAC
CTGAAAAACTTTCCCTTGCGTTTCCGAGTTTTGTTTTAATGTGTTCCATGTGATTAACTT
TGTACGTTTATAGAACCCTTTTTTAAAAACCAATGGAAATACACGGAATCCCGTTGACCT
TTTTTGCCACAAAGAAAATTTTCATTACGTTTCGCAGAATTTGNTGGTAGNTTGCTCTTT
CTGGCCGTTTATCGGGCCGTTGNTTTGCTGGTGGTTTNCCGNGAGGGGACGCCGCAATTT
TTTCATTTCACCTNCGCTNGTTCCAGTTACGGAAGCCACCCCCACCATTTGTAAAAGGCC
TTAGCGGTTTGGCCGGNCCCCCAACAANTATGGAAAGCGGGTNCCGTATTTCGCACATTT
CNGCCGGNTCCNAACCATTAANAGCTATTTAAGGGAACCTTTGGGAGNCGGGGGGNCACG
GGNNTTTGGGGTTNCAAAGNNCCAAAGNCCAGGGGCGAANATGGCTGGTGGCTGCTNCAG
AANTATTGCGTAAAAAGGNTGAAGTCTTTTTCCCTGAGATTTGNTCCGGAGAAANANATA
AANANAAGAAACCGGNNNNCnaaagaaanccnatnnttggtggggggcccgtttttnnag
gaagggcaagccnttcccnnatnntantncttttnagnacccaacnaaatccntgaagaa
gctatcctggggcattaaaatccacggaattggggagnttataaagaagagctgccggnc
aatcgaaanagcaactggcnttggaccttngnactactctnttccgaggagaagnncccn


CLOSE