Detailed Information [103922]

Strain Information
DGRC Number 103922
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1185 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1185 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 55F8
Map Viewer
Related Genes Dpt Jheh3
Original Number 1185
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1185

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 861
General Information NP_lines
Lethality lethal
Embryonic Expression sg
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np20025_0807
Strand Minus
Insertion Point 13925831
Chromosome Band 2R
Flanking Sequence
actntctntggcgtgacactgccatttatnttgtatacttcggtaagcttcggctatcga
cgggaccaccttatgttatttcatcatgTGCGAGACAATTCGGGGAATGAGTATATGCGC
CGGCAGTCAGTTCTTTAGCGGCTTTCTGGTTGCACGGTCGTGTTTATTCCGAATTCGGGT
TAGGAATCACAAACCATTATCTCTTCTGGGAGGTGTACGAGGTGGCTNATTTAAATTCAT
AACGAGTGGGGGAGCTAATTGCGCCTGTGGCCAGAATGAAGTGCCTGATAGTGTTTGGGC
TGATTGTGGCCCTGTTTGGTGCCTTCGTGGGCTATGGCTACGTGGTATTCACGgatcgaa
gaatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcagga
agggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccc
tgggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgata
cagtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattc
tatgctgtctcaatgttagaggcatatcagtctcactngntnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnn


CLOSE