Detailed Information [103928]

Strain Information
DGRC Number 103928
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1201 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1201 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 33D1
Map Viewer
Related Genes rho-6 Gr33a
Original Number 1201
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1201

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1163
General Information NP_lines
Lethality lethal
Embryonic Expression sg (SG)
Larval GFP gut
Larval X-gal sg, mt
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03615_0711
Strand Minus
Insertion Point 12123725
Chromosome Band 2L
Flanking Sequence
tnaacgtgcactgcanttaagtgtatacttcggtaagcttcggctatcgacgggaccacc
ttatgttatttcatcatgAGCCAAACAATTATTTCCAACGCTCTTGTGCATCCCCCCCTC
TCTTTCGACATTTCTATTTCGCAATGCTGCCATCTCTTTCGCATCCGCCGAGAAGCCAAA
AGTGCTCTTTATTGCTTGTTACATAAATATTTCATTAAAAGCCATTCATAACCAAGCATT
CGGTGTTGACAGTCGCCTCCCACCATCAACGCCCACGCCCACGCCCACCACGTGTCCAAC
GTAGAAAGAGACGCCTGCTGCCAAACGAAAGAGAGAGAGAAATTTTCCTCTTGCACTTTC
ACTTGCAGTTGAATTTGCGAACGGTTTGGTAAAGAGGATTGAAAAACAAGATTTGTGGAT
TTTGGTTTTTATACTAGGTAAAATTCAAAACACATTACCAATTACAATTACCAACACACC
CATTTTCGNAGGTTTAATTTTTTTCTTATTTTTTTAAAACATTTCGGAACTATTAAATNT
TGNGGTTTCAATTATAAAATTAGTCNTGGTAATTGGGAATCATGGCTTATTGGACATNGC
TTTATGTATGGCGATCCGNAGAATACATAAGNAGAGAANCCCGNNCGCCAAAGGAACCCA
ATTTTTGGNGGGGGGTCCNGTNTTCAGGGAANGGGGNAAGCCNATCCCGACCATGGNANT
NCCTNTTNNAGAACCAANTCAAAANTCCANGAAGNGCNTATCCCCTGGGGCTNAAAAATC
CAACCGGAAATNGGGGGNAGttnatnatgaatgangctggncgggagtcaattcgataca
gncnaactgnncttngnccccttggtnactactnctcttnccgatgganganggncgcga
cttattttntgnctggccnaagggtagagggnatatnancnacggcanannnntnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnn


CLOSE