Detailed Information [103930]

Strain Information
DGRC Number 103930
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}Pen[NP1205] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}PenNP1205 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 31A1; -; 31A2
Map Viewer
Related Genes CG4791 Pen CG4804
Original Number 1205
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1205

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1145
General Information NP_lines
Lethality semi lethal
Embryonic Expression dorsal midline (SG)
Larval GFP tr fusion cells, genital disc.
Larval X-gal epi
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03645_0711
Strand Plus
Insertion Point 10049362
Chromosome Band 2L
Flanking Sequence
ttttaacgtgcactgnatttaagtgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgGGCTTGCTTTTCAAATCAAACGGTAAATTCTGGCGGCGCC
AAGCAGGCATTGACTCCAATTTCGCATCGATTACGAGAGTACTGTCTACGTTTGTCTACA
GTTTCACCGGCACATTCAGCGTGCTAACACGCTCGACAAATTCTCGTGCTCGCGTTTCGT
TAGGGAACGATAAAAATTGTGTAAAAATTCAGTAAAGTGAATTTCCATCCGAAAAAGCCA
GCACACGCATTCAAAAGGGCAAAGGTACAAAGGTAAGTGCGTGTGTACTCTTTTCTTCCT
TTTCGCGGTTTTTCCCACTGCTTTTTACTAGCGTTCATCAATTTGACCGCCTCTTCGTga
tcgaagaatacataagagagaaccgtcgccaaagaacccattattgttggggtcccgttt
tcaaggaaggggcaagccatccgacatgtcatcctcttcagacccaatcnaatccaatga
nagagcatcccctggggcattaaaatccaacggaattgtgggagttatnattgatggagc
tgncgagtcaatcgatacagtcaacctgtcntttgacctttggtactactctcttccgat
gatgatgntcgcacttatttntatgctgtcctcaatgttagaggcatatcagtctcatng
ctnnttttnnttnnngngngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnannnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnn


CLOSE