Detailed Information [103945]
 

Strain Information
DGRC Number 103945
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1227 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1227 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 39C1
Map Viewer
Related Genes CG8671 Cyp6t2Psi Cr1a{}486
Original Number 1227
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1227

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1289
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Lethality semi lethal
Embryonic Expression sg (SG)
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Chihara T, Kitabayashi A, Morimoto M, Takeuchi K, Masuyama K, Tonoki A, Davis RL, Wang JW, Miura M.
Caspase inhibition in select olfactory neurons restores innate attraction behavior in aged Drosophila.
PLoS Genet. (2014) 10(6) e1004437 [PubMed ID = 24967585] [RRC reference]

Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03805_0711
Strand Plus
Insertion Point 21246287
Chromosome Band 2L
Flanking Sequence
atttttngngtgcantgccnttatttgtatacttcggtaagccttcggctatcgacggga
ccaccttatgttatttcatcatgTTCTAGCACAACACGCACACATATACGCGTTCTCGTC
TCTTGTTTTTACTCACACAAGCAAGCAAATTCTATTTTTAGATTTCTTATGTTCTCAGCG
TGAGCGAGCGGAAAGAGAGCAATTTTGGCCGTCACCAAAAAAGTGGCTGCATAGTGCCAA
ACCAATGTATGGCCGTTACGCATCTTGTTATTCTAGTGTCTTTGGTTTTGGCAGTATGCT
TTTTGTTTGTTAAGTCCTAGCCTTGCTTGGACCATTGGCCTTTTCAAGACCAAGAAATCT
GTAAAAGTTTAGTATTCTTATTTAAGCGGTGTATAAGTTGTTTTAATTCCTACAGTTTCT
AAAAGTAGTGCAATTTATATTATTATTCAAAAGCGATGGCTTGAACAAGCCTGTTTAGGG
TTTCATTAATACTTAACACCTAACATATTTGTTTTTGTTTAATTTTACTTATACTTTATA
CTTACGTTATTTATTGGNTGCATTTTTTGTACTAATTCTGCTTTCTTAATAATTTCTGTC
TTTCTTTTTTTTAACTAACATTATGTTTTATGTATAAACTGGGGTAAATGGGCCAACTTA
ACCAACCAAAAAATTACATTCTTTAAAATACAATCAATAAACGACTGGCCTGCGCTCGNA
ATATATAACAAAAAATCTACAGTCGCTTTANAAAAATCCGNTTCTNTACTTAAATAGGAC
TCAATCAGNAGAGCAATTTAatggtntggaaattcaatnntaccacatagcccnacagga
acggtcnaaagggnngagagcntcaacaatgtaacagcttgggagngggtgtagccaaan
cccccaggttatactcatttaanctcagcacccttgttgnataccccggcgangaacagc
tntaccaanc

CLOSE