Strain Information | |
---|---|
DGRC Number | 103948 |
Genotype with FlyBase Link | y[*] w[*]; P{w[+mW.hs]=GawB}NP1233 / CyO, P{w[-]=UAS-lacZ.UW14}UW14 |
Genotype | y* w*; P{w+mW.hs=GawB}NP1233 / CyO, P{w-=UAS-lacZ.UW14}UW14 |
Break points/Insertion Site | 36E1 |
Map Viewer | |
Related Genes | CG5790 Fas3 |
Original Number | 1233 |
Chromosome | 2 |
Comments | FlyBase Insertion: P{GawB}NP1233 NP line. Received from the National Institute of Genetics. |
Balancer | CyUW14 |
Cluster id | 1232 |
General Information | NP_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Embryonic Expression | visceral mesoderm (SG), AS |
Larval GFP | ubiquitous |
Larval X-gal | sg, gut, mt |
Adult GFP | ubiquitous |
Reference | |
Last update | 2020-04-03 |
Research papers using this strain [Please submit your publication] |
Ridwan SM, Twillie A, Poursaeid S, Beard EK, Bener MB, Antel M, Cowan AE, Matsuda S, Inaba M. Diffusible fraction of niche BMP ligand safeguards stem-cell differentiation. Nat Commun (2024) 15(1) 1166 [PubMed ID = 38326318] [RRC reference] Hudry B, de Goeij E, Mineo A, Gaspar P, Hadjieconomou D, Studd C, Mokochinski JB, Kramer HB, Placais PY, Preat T, Miguel-Aliaga I. Sex Differences in Intestinal Carbohydrate Metabolism Promote Food Intake and Sperm Maturation. Cell (2019) 178(4) 901-918.e16 [PubMed ID = 31398343] [RRC reference] Kain P, Dahanukar A. Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain. Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference] Wolfstetter G, Holz A. The role of LamininB2 (LanB2) during mesoderm differentiation in Drosophila. Cell Mol Life Sci (2012) 69(2) 267-82 [PubMed ID = 21387145] [RRC reference] Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S. GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps. Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | np / np03845_0711 |
Strand | Plus |
Insertion Point | 18298176 |
Chromosome Band | 2L |
Flanking Sequence | atttttggtgcactgncnttaantgtatacttcggtaagcttcggctatcgacgggacca ccttatgttatttcatcatgCACGGAGCGGATTCAGTCGTTTGGTAACTGTTGCTCCTAT CAGTCGTTCTCTGTCGCTCTTGGATTGCGTGGGCACATCGGTCGTTCGGCATTTTGGGTT CGGCATTTCGGGATTTGATATCGTTATTCGTGTCGGAATCGTATAAACCTGCGTCCGTGT GCGTTAGCCGGCCATTGAGCACTATCGCTGCCACTGGCATTTGGCCCACCGTGTGTGTTT ACAAGTGTGGCATAATCTTCGATTAGCGCAAACCAACCgatcgaagaatacataagagag aaccgtcgccaaagaacccattattgntggggtccgttttcaggaagggcaagccatccg acatgtatccttttcagaccaatcaaatccatgaagagcattcctgggcataaaatccaa cggaattgnggagntatcatgatgagctggcgagtcaatcgatacagncaactgncnttg acccttggtactactcttttncgangatgatgncgcacttattctatgctgnctcaatgg tagaggcatatcagtctcactgagntcnnnnnnnnnnngngnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnaaaaannnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnann |