Detailed Information [103948]
 

Strain Information
DGRC Number 103948
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1233 / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}NP1233 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 36E1
Map Viewer
Related Genes CG5790 Fas3
Original Number 1233
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1233

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 1232
General Information NP_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Embryonic Expression visceral mesoderm (SG), AS
Larval GFP ubiquitous
Larval X-gal sg, gut, mt
Adult GFP ubiquitous
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Vaikakkara Chithran A, Allan DW, O'Connor TP.
Adult expression of the cell adhesion protein Fasciclin 3 is required for the maintenance of adult olfactory interneurons.
J Cell Sci (2024) 137(12) [PubMed ID = 38934299] [RRC reference]

Ridwan SM, Twillie A, Poursaeid S, Beard EK, Bener MB, Antel M, Cowan AE, Matsuda S, Inaba M.
Diffusible fraction of niche BMP ligand safeguards stem-cell differentiation.
Nat Commun (2024) 15(1) 1166 [PubMed ID = 38326318] [RRC reference]

Hudry B, de Goeij E, Mineo A, Gaspar P, Hadjieconomou D, Studd C, Mokochinski JB, Kramer HB, Placais PY, Preat T, Miguel-Aliaga I.
Sex Differences in Intestinal Carbohydrate Metabolism Promote Food Intake and Sperm Maturation.
Cell (2019) 178(4) 901-918.e16 [PubMed ID = 31398343] [RRC reference]

Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Wolfstetter G, Holz A.
The role of LamininB2 (LanB2) during mesoderm differentiation in Drosophila.
Cell Mol Life Sci (2012) 69(2) 267-82 [PubMed ID = 21387145] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np03845_0711
Strand Plus
Insertion Point 18298176
Chromosome Band 2L
Flanking Sequence
atttttggtgcactgncnttaantgtatacttcggtaagcttcggctatcgacgggacca
ccttatgttatttcatcatgCACGGAGCGGATTCAGTCGTTTGGTAACTGTTGCTCCTAT
CAGTCGTTCTCTGTCGCTCTTGGATTGCGTGGGCACATCGGTCGTTCGGCATTTTGGGTT
CGGCATTTCGGGATTTGATATCGTTATTCGTGTCGGAATCGTATAAACCTGCGTCCGTGT
GCGTTAGCCGGCCATTGAGCACTATCGCTGCCACTGGCATTTGGCCCACCGTGTGTGTTT
ACAAGTGTGGCATAATCTTCGATTAGCGCAAACCAACCgatcgaagaatacataagagag
aaccgtcgccaaagaacccattattgntggggtccgttttcaggaagggcaagccatccg
acatgtatccttttcagaccaatcaaatccatgaagagcattcctgggcataaaatccaa
cggaattgnggagntatcatgatgagctggcgagtcaatcgatacagncaactgncnttg
acccttggtactactcttttncgangatgatgncgcacttattctatgctgnctcaatgg
tagaggcatatcagtctcactgagntcnnnnnnnnnnngngnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnaaaaannnnnnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnann

Image Files
Embryo

e1 (->Large)

e2 (->Large)

e3 (->Large)

CLOSE