Detailed Information [103972]

Strain Information
DGRC Number 103972
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}14-3-3epsilon[NP1301] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}14-3-3εNP1301 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 90F7
Map Viewer
Related Genes CG18598 14-3-3epsilon CG7156
Original Number 1301
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP1301

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:90F4 (Uemura), 90E4-F7(Goto)
Balancer TM6UW23-1
Cluster id 1531
General Information NP_lines
Lethality semi lethal
Embryonic Expression pns subset (SG)
Larval GFP pns
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np20745_0807
Strand Minus
Insertion Point 14069422
Chromosome Band 3R
Flanking Sequence
antttngcgtgcactgcatttantttgtatacttcggtaagccttcggctatcgacggga
ccaccttntgttatttcatcatgCCCCTGCCCCACAATCATTGATTTTGGGTGTGGAATA
AGTGTATTTAAGAAACTAGAATCCCCAAAAAATGTGTCGTTTCTAGAAAGTTACGCCTTG
ACAACTACTAAGAAAGAAAAAAAAAGAACGCGAACTGGAATCAACTGCAAACAGCCCTTA
GCAACCAAGGAAGAAAATAAAATGCTAGCTGCCGCGCAGCCCTTGCTCGCAACGCCAAAT
ACACAAAATTTTCCCCTTCTAAACTAATACTATATAGTTCCAAAAAAGAAAGAGCGGAGC
AAACTATTTGCTGTAAATTATAATACGCAATTCCGTTTCTTTCTCTTTTTGTGCAAAACC
ACGCGAATTTTTGCCGGTAAAAATCAGGTTTTACACTCTATTCATCTCTTTTCGTTCTTC
CGACGCTCTGCTTCTTCTTCGGCTTCTTCCTCTTCTTACTGTTTCCTCCATCTCCCGTTC
TTTTCGCAAGAAATACTACTCATCGCGACGCTGCGTCGCTTCGAATGCAGCTACAGCGAT
GAAAATTGAAAATTTCCATCGTTTTCTCTGGAAGAAAACCTTTTAATTGGCACATTCGGA
CGAAAAGCGGGGCTCTAGACTTTTTTAACGACCACGCGACGACGCAATGGATCGAANAAT
ACATAAGANAGAACCGGCNCCAAANAACCCATTATTGGTGGGGGNCCGTTTTCANGAAGG
GCAGGCCTTCCGAAATGGTAttcctnttnanaccaatcaaaancatgnaaagcctncctg
ggcatnaaanccacgggaatgggggngttttcatgagagccggcgngnnaatnnaacagn
nnacnggntttgacctttgnaccactctcttccgagaagaaggngccctattnttgcggn
cnaanggaag


CLOSE