Detailed Information [103986]

Strain Information
DGRC Number 103986
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1321 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP1321 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 68A4
Map Viewer
Related Genes Mocs1 CG6310
Original Number 1321
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP1321

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1856
General Information NP_lines
Embryonic Expression sg
Larval GFP no larva
Larval X-gal oenocyte
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np26275_0807
Flanking Sequence
gtnaacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgGTCCATATGATCGAAGANTACATAAGAGAGAACCGNCGCCA
ANGAACCCATTATTGTTGGGGTCCGTTNTCAGGAAGGGCAAGCCATNCGACATGTNATCC
TCTTCAGACCAATCAAATCCATGAAGAGCATCCCTGGGCATAAAATCCAACGGAATTGNG
GAGTTATCATGATGAGCTGCCGAGTCAATCGATACAGTCAACTGTCTTTGACCTTNGTTA
CTACTCTCTTCCGATGATGATGTCGCACTTATTCTATGCTGTCTCAATGTTAGAGGCATA
TCAGTCTCCACTGAGCATNTNNNNNTTGGNNNNGGNNTNGNGGNNGNNATNATGANGAGC
TGNCNANNNAANNNATNCANNCAACTGNNTTTGNCCTTNGNNNCTNCTNTTTNCNANGAN
GANGNNNNNCTTATTNTATGNNGNNTNAANGNNANAGGCNTNTNANNNTNCACTGAANCA
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Library Name / Clone Name np / np61073_0309
Strand Minus
Insertion Point 11028082
Chromosome Band 3L
Flanking Sequence
tttttactgcgcacttattgcaagtcatacgttaagtggatgtctcttgccgacgggtac
caccttatgttatttcatGCATGATATGGACGAGCTGCCAGCGCAGCTTTCGCCAAAGCT
TTTGTTATAGTGCCAGTGTTAGGCAGCATTTGAAATTTTTTGCCGGTGGATTGATTGTAT
TAAGGGGGGGGGGGGGGGNCCCCCACGGGGATNCCCNNANAANNTTTNTNCCTCCAAAAA
NCTAGACCNAAAGGGGNANNCCCGGNCNANAATTCNCTTTTTAAAGNANGGGGGTTAAAT
TCANTTNTTTTNCTTNNGGTTNNNAAAAAANNNTTAANTTTTCTTTTNNNTAAAAANGNC
NTNCNAAAAGGTTNNNTNCNNNTTAAAAANAANGGNTTTNAAACTTTAANCCTNTAAANT
TTGGCNCTNNTAGGTNGGTTTTTAAAATTTTTTTTTAAATTTCCCCCCNCTTNAACCNTA
NNAANNTNNCNNNNNCCNANNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTNNNNNNNNNNNNNNNNNNNNNNNNNNNCNNNNNNNNNNNNNNNNNNNNNNNNNNNTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTNNNNNNNNNNNNNNNNNNNTNNNN
TNNNNNNNNNNNNNNNNNNnnnnnnnnnnnnnnnnnnnnnnnncnnnnnnnnnnnnnnnn
nntnncnnnnnnnntnnncnnnnnnnnnnnnnnnnnnnnnntanntnnnnnnntnttttc
nnncnnnnnnntcntnt


CLOSE