Detailed Information [103988]

Strain Information
DGRC Number 103988
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1325 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP1325 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 98A1
Map Viewer
Related Genes CG13978 side
Original Number 1325
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP1325

NP line. Received from the National Institute of Genetics.

Original Comments comment1:A, comment2:98A1
Balancer TM6UW23-1
Cluster id 1656
General Information NP_lines
Embryonic Expression cns + pns subset (SG)
Larval GFP cns + pns
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np20275_0807
Strand Plus
Insertion Point 23252669
Chromosome Band 3R
Flanking Sequence
gggggcaggnttgtttnntttttttggnngantcacacggttgtgaaaatnncccattnt
nttggggacnnncggaaagccntcggctattcgacgggnaccaccttntgttatttcatc
atgCTACGGGGTAGCAACACATGCCGCATATCATTCACGATTTTTCACTTCGGACGGCGA
CGAGCTTCGgatcgaagaatacataagagagaaccgtcgccaaagaacccattattgttg
gggtccgttttcaggaagggcaagccatccgacatgtcatcctcttcagaccaatcaaat
ccatgaagagcatccctgggcataaaatccaacggaattgtggagttatcatgatgagct
gccgagtcaatcgatacagtcaactgtctttgacctttgttactactctcttccgatgat
gatgtcgcacttattctatgctgtctcaatgttagaggcatatcagtctccactgaagcc
atcttnnnnttnggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
atnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnntnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnn


CLOSE