Detailed Information [103992]

Strain Information
DGRC Number 103992
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}NP1330 / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}NP1330 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 84D9
Map Viewer
Related Genes alpha-Est9 alpha-Est10
Original Number 1330
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP1330

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1372
General Information NP_lines
Lethality lethal
Embryonic Expression oenocyte (SG)
Larval GFP sg
Larval X-gal sg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np17755_0807
Strand Minus
Insertion Point 3317450
Chromosome Band 3R
Flanking Sequence
ntgtttgnggtgcactgaatttangtgtatacttcggtaagcttcggctatcgacgggac
caccttatgttatttcatcatgCGCTGTGCAAAAGCACTGAGAGAAAGAGAGAGAGTTTG
GAGAGTGGCAATAACGCCACCGCTCCAAAGCTTCAAATATTAGTATAAACAAgatcgaag
aatacataagagagaaccgtcgccaaagaacccattattgttggggtccgttttcaggaa
gggcaagccatccgacatgtcatcctcttcagaccaatcaaatccatgaagagcatccct
gggcataaaatccaacggaattgtggagttatcatgatgagctgccgagtcaatcgatac
agtcaactgtctttgacctttgttactactctcttccgatgatgatgtcgcacttattct
atgctgtctcaatgttagaggcatatcagtctccactgaagccatcttatttntggnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnn


CLOSE