Detailed Information [104001]

Strain Information
DGRC Number 104001
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}gish[NP1352] / TM6, P{w[-]=UAS-lacZ.UW23-1}UW23-1
Genotype y* w*; P{w+mW.hs=GawB}gishNP1352 / TM6, P{w-=UAS-lacZ.UW23-1}UW23-1
Break points/Insertion Site 89B16
Map Viewer
Related Genes CG31283 Zip3 gish
Original Number 1352
Chromosome 3
Comments FlyBase Insertion: P{GawB}NP1352

NP line. Received from the National Institute of Genetics.

Balancer TM6UW23-1
Cluster id 1516
General Information NP_lines
Embryonic Expression pns subset?
Larval GFP weak
Larval X-gal mg
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Kain P, Dahanukar A.
Secondary taste neurons that convey sweet taste and starvation in the Drosophila brain.
Neuron (2015) 85(4) 819-32 [PubMed ID = 25661186] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np20775_0807
Strand Plus
Insertion Point 12112297
Chromosome Band 3R
Flanking Sequence
NNNNNTGNTCTTCGGTAGCTTCGGCTATCGACGGGACCCCTTATGTTATTTATCATGGGT
AACCCACCTTGTGCATAATTTTATTTATAGCGCTTGGTTTATTTTTAATTATCGATTTGG
TTTTCCCTGCTTTCAAACGCAACAAACAAAATATAGAATATTAAGAACATGTGTGATCGA
AGAATACATAAGAGAGAACCGTCGCCAAAGAACCCATTATTGNTGGGGTCCGTTTTCAGG
AAGGGCAAGCCATCCGACATGTCATCCTNTTCAGACCAATCAAATCCATGAAGAGCATCC
CTGGGCATAAAATCCAACGGAATTGNGGAGTTATCATGATGAGCTGGCGAGTCAATCGAT
ACAGNCAACTGGCTTTGACCCTTGGTACTACNCTCTTNCGAAGAAGATGGCGCACTTATT
CTATGCTGGCTCAANGNTAGANGNATATTAGTCTTCACTGGAGCCATTTTTTTTTTGGGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNnnnnnnggnnnnnnnnnngnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnan


CLOSE