Detailed Information [104028]

Strain Information
DGRC Number 104028
Genotype with FlyBase Link y[*] w[*]; P{w[+mW.hs]=GawB}dve[NP1550] / CyO, P{w[-]=UAS-lacZ.UW14}UW14
Genotype y* w*; P{w+mW.hs=GawB}dveNP1550 / CyO, P{w-=UAS-lacZ.UW14}UW14
Break points/Insertion Site 58D2
Map Viewer
Related Genes dve CG5819
Original Number 1550
Chromosome 2
Comments FlyBase Insertion: P{GawB}NP1550

NP line. Received from the National Institute of Genetics.

Balancer CyUW14
Cluster id 912
General Information NP_lines
Lethality lethal
Embryonic Expression cns, glia? (SG), a small subset of muscles (MY)
Larval GFP cns
Larval X-gal pouch
Adult GFP internal
Reference Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Yorimitsu T, Kiritooshi N, Nakagoshi H.
Defective proventriculus specifies the ocellar region in the Drosophila head.
Dev. Biol. (2011) 356(2) 598-607 [PubMed ID = 21722630] [RRC reference]

Hayashi S, Ito K, Sado Y, Taniguchi M, Akimoto A, Takeuchi H, Aigaki T, Matsuzaki F, Nakagoshi H, Tanimura T, Ueda R, Uemura T, Yoshihara M, Goto S.
GETDB, a database compiling expression patterns and molecular locations of a collection of Gal4 enhancer traps.
Genesis (2002) 34(1-2) 58-61 [PubMed ID = 12324948] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name np / np51505_0227
Strand Minus
Insertion Point 17314330
Chromosome Band 2R
Flanking Sequence
ngtnacgtgcactgaatttaagtgtatacttcggtaagcttcggctatcgacgggaccac
cttatgttatttcatcatgAACATGTGGCTCTTGGCTCTCTCTCTCTCTGCTGCTCTCAC
TATCGCCACTCACAAACACAGACGCACACCCCCAGCCCCTCTCTCATTCCTGCTGCCTCT
CGCTCTCTCTGCCTCGCCCCATCTCGCTTGCTCTACCGTTAAGCCCTGGCCCCGCATTAC
GCTTATCAAAGTATATCTCTGGGATTATACGAAATGAATGGAATTAAGGATTAATTTCCA
AGGGATGTCATTTCGTTTTGGGATAATGCCCCAGTTGTACGTGTGTATGCGTCTGTATCT
GGGTGTTGGTGTTGGCAGCAGCTTAAGCTATAATGGATTCGGGTTCACAGTTTCCCGTCG
CCGAACGCTCTAGCTGAAGCTGTCGCAGGCGATGCTAAGGTTTGGTTATAAAAATACACC
GGAGTTTATAATGCCAAAGCGGGTTATAGAGCAGTGGCGTGCTAACCTCGAATAAAGGTG
CTCAGCATTTGGGATAAGTACGGTGCATGGTGGATGGGGGGGTGGGATTATAAAAAGGGG
GGAGAACATGAACTGCATTACAAAACCTAGAGCTACAATGTATCCAAAATGTATTTAGAT
GAGATCGAAGAATACATAAGAGAGAACCGNCGCCAAAGAACCCATTATTGNTGGGGTCCG
TTTTCAGGAAGGGCAAGCCATCCNACATGTNATNCTNTTNAGACCAATCAAATCCATGAA
GAGCATCCCTGGGCATAAAAtccaacngnaattggngggggttntnatgagagctgncgn
gnnaatnnatncanncnactgnntttgaccttngntnctactntnttncgangangangn
cnnncttattntntgctgnnnnaaggtagaggcann

Image Files
Disc

d1 (->Large)


CLOSE